The work of cracking the genetic code in the 1960s was to understand the encryption of life. Photo: Getty
Show Hide image

Life itself is encrypted – but can you find the Easter eggs?

Art and science both had a long history of secret codes hidden in plain sight. Adam Rutherford goes on the hunt.

“To live, to err, to fall, to triumph, to recreate life out of life” – what a fitting sentiment to accompany the birth of a new organism. It’s a quotation from James Joyce’s Portrait of the Artist as a Young Man, and came as part and parcel with the creation of the first synthetic cell in 2010. Synthia – as it became known – was constructed by the scientist Craig Venter, who assembled its genetic code in a computer, and wheedled it into the chassis of an eviscerated cell, whereupon it became alive. The quotation, along with two others also encrypted in DNA, was buried in its genome.

Life itself is encrypted. DNA is the code – a set of instructions on how to build an organism. The work of cracking the genetic code in the 1960s was to understand the encryption of life. It did just that, as we now understand not just how genes work in living things, but how the rusting codes in our genomes betray our evolutionary history. Genes that were once vital are no longer, but leave coded shadows in our DNA.

Venter’s project was steganography – the art of hiding messages within another work. His motivation, I suspect, was partly hubris, but ostensibly to watermark the genome as manmade. But it comes from a long, fun, and seriously nerdy tradition that covers pretty much every cultural form. These messages are now more commonly known as Easter eggs, primarily from the hunts devised by programmers hiding treats in software. Many of us remember the excitement of discovering “the Hall of Tortured Souls” – a 3D adventure encoded by a disgruntled employee in Microsoft’s fairly rubbish Excel 95 spreadsheet, only accessible via a code in a particular cell. Video games are crammed with Easter eggs, and the race to find them is now standard practice. It suits the medium so well because the code itself is largely invisible and impenetrable to the user.

Easter eggs in music are legendary, frequently recorded backwards, or “backmasked”. The Beatles did it, Pink Floyd too. Play Jay Z’s track “Lucifer” backwards, and it may well say “666, murder murder Jesus”. Some satanic, some godly, these messages are mostly plain silly, but none more so than Ozzy Osborne’s on his track “Bloodbath in Paradise”, openly – secretly – mocking the devilish decrees of his metal brethren: “Your mother sells whelks in Hull.”

In books, recall, if you can, Kit Williams and his beautiful Masquerade. Published in 1979, every page contained a clue to the location of an 18-carat golden hare, which was buried under the shadow cast by a crucifix at midday on the autumn equinox. Novelist Ernie Cline launched a modern quest in his wickedly fun 2009 book Ready Player One – a tale of a global hunt to find three Easter eggs hidden in a huge future online world, the prize being ownership of the mega-billion dollar company. It’s irresistible to us of a certain age and geekiness, as the book is littered with references to 1980s video games and films such as Ghostbusters and Back to the Future. But what no one knew was that there was a real hunt in the book itself. It was claimed in 2011 – the prize: a Delorean.

In cinema, the practice is rife too. Each movie from the animation studio Pixar hides a character from their next film. The Toy Story films are weirdly laden with references to Stanley Kubrick’s horror The Shining, from the creepy iconic 1970s carpet, to the apposite name of a security camera in the Toy Story 3 – Overlook 237 – a reference to the Hotel, and its spookiest room. Even film posters are not immune to steganography. The one-sheet for Silence of the Lambs features the image of a skull on the back of a death’s head moth covering Jodie Foster’s mouth. Look carefully and you’ll see it’s actually composed of naked women – as indeed are the irises of the classic jazz-age cover of The Great Gatsby.

Books, DNA, films and Easter eggs: these are some of my favourite things. Which brings us to my book Creation. It was published in 2013, about the parallel sciences of origin of life research, and genetic engineering. I, like plenty of film nerds, have good recall for lines from movies. Simply for my own amusement, I always hide them in scripts, articles and books. Mostly these go unnoticed. Mostly. Creation has plenty, 20 at last count, some explicit, some merely a reference or paraphrase. In doing so, I had inadvertently hidden Easter eggs in a book in which I describe DNA Easter eggs. And thus the game was afoot. Creation is a book in two halves, and its gimmick is that both halves have their own cover, and are inverted, so you can read each from either direction. Many people asked me what happens in the middle of the paperback, to which the answer was, it contains the following text:

TTCTAGCTGCTGTAGTGGTAGAGGTACTGCACCTAGCTGGCC
GGCGTGAGCTGCGTGAACATCTGCGTGCTGGTGAGCTGCGCC
AACGACATCGACGTGAGC

Using a standard DNA cipher described in the book revealed that that code spelt out this:

CREATI.NATVKD.TPENGVINGR.VPD.TC.M

The encryption I used doesn’t have O or U in it, but, my presumption was that anyone sharp enough to translate it would spot the full stop ‘CREATI.N’ stood in for an O, and the V in PENGVIN stood in for a U, and thus realise that it is an email address. We put it out on Twitter, and the first email arrived an hour later. The people who wrote to it were directed to a website, which contained a video. That film was a mock of the denouement of the Usual Suspects, in which (spoiler alert) the plot is revealed to be almost entirely unreliable by clues on a notice board. In my appallingly acted version, the instructions were given to hunt down my own watermarks, homages, and games: three quotations buried in the text.

A week later, four winners had all claimed their prizes, a stack of books from Penguin. They all found a line from “Life on Mars” by David Bowie. Two identified a made-up word from The Simpsons, and one a made-up creature from The Princess Bride. But in total the winners only found eight. The official hunt is over, but can you do better? Start at the very beginning. It’s a very good place to start.

Adam Rutherford is the author of Creation which has been shortlisted for the Wellcome Book Prize 2014

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: “Playing God” (BBC2) as well as numerous other programmes for BBC Radio 4. Creation is his first book. It is shortlisted for the Wellcome Book Prize 2014.

Getty
Show Hide image

Peculiar Ground by Lucy Hughes-Hallett asks how we shape history and how much is beyond our control

In Wychwood, a great house in Oxfordshire, the wealthy build walls around themselves to keep out ugliness, poverty, political change. Or at least they try to. 

The great cutting heads of the Crossrail tunnel-boring machines were engines of the future drilling into the past. The whole railway project entailed a crawl back into history as archaeologists worked hand in hand with engineers, preserving – as far as possible – the ancient treasures they discovered along the way. One of the most striking finds, relics of which are now on display at the Museum of London Docklands, was a batch of skeletons, unearthed near Liverpool Street Station, in which the bacteria responsible for the Great Plague of 1665 were identified for the first time. Past and present are never truly separable.

Lucy Hughes-Hallett’s ambitious first novel ends in 1665 in the aftermath of that plague, and it, too, dances between past and present, history and modernity. Like those skeletons buried for centuries beneath Bishopsgate, it is rooted in the ground. The eponymous “peculiar ground” is Wychwood, a great house in Oxfordshire, a place where the wealthy can build walls around themselves to keep out ugliness, poverty, political change. Or at least that is what they believe they can do; it doesn’t spoil the intricacies of this novel to say that, in the end, they will not succeed.

It is a timely idea. No doubt Hughes-Hallett was working on her novel long before a certain presidential candidate announced that he would build a great wall, but this present-day undiplomatic reality can never be far from the reader’s mind, and nor will the questions of Britain’s connection to or breakage with our European neighbours. Hughes-Hallett’s last book, a biography of Gabriele d’Annunzio, “the John the Baptist of fascism”, won a slew of awards when it was published four years ago and demonstrated the author’s skill in weaving together the forces of culture and politics.

Peculiar Ground does not confine itself to a single wall. Like Tom Stoppard’s classic play Arcadia, it sets up a communication between centuries in the grounds at Wychwood. In the 17th century, John Norris is a landscape-maker, transforming natural countryside into artifice on behalf of the Earl of Woldingham, who has returned home from the depredations of the English Civil War. In the 20th century a new cast of characters inhabits Wychwood, but there are powerful resonances of the past in this place, not least because those who look after the estate – foresters, gardeners, overseers – appear to be essentially the same people. It is a kind of manifestation of what has been called the Stone Tape theory, after a 1972 television play by Nigel Kneale in which places carry an ineradicable echo of their history, causing ghostly lives to manifest themselves through the years.

But the new story in Peculiar Ground broadens, heading over to Germany as it is divided between East and West in 1961, and again as that division falls away in 1989. Characters’ lives cannot be divorced from their historical context. The English breakage of the civil war echoes through Europe’s fractures during the Cold War. The novel asks how much human actors shape history and how much is beyond their control.

At times these larger questions can overwhelm the narrative. As the book progresses we dance between a succession of many voices, and there are moments when their individual stories are less compelling than the political or historical situations that surround them. But perhaps that is the point. Nell, the daughter of the land agent who manages Wychwood in the 20th century, grows up to work in prison reform and ­observes those who live in confinement. “An enclosed community is toxic,” she says. “It festers. It stagnates. The wrong people thrive there. The sort of people who actually like being walled in.”

The inhabitants of this peculiar ground cannot see what is coming. The novel’s modern chapters end before the 21st century, but the future is foreshadowed in the person of Selim Malik, who finds himself hiding out at Wychwood in 1989 after he becomes involved in the publication of an unnamed author’s notorious book. “The story you’re all so worked up about is over,” he says to a journalist writing about the supposed end of the Cold War. “The story I’m part of is the one you need to think about.”

A little heavy handed, maybe – but we know Selim is right. No doubt, however, Wychwood will endure. The landscape of this novel – its grounds and waters and walls – is magically and movingly evoked, and remains in the imagination long after the reader passes beyond its gates. 

Erica Wagner’s “Chief Engineer: the Man Who Built the Brooklyn Bridge” is published by Bloomsbury

Erica Wagner is a New Statesman contributing writer and a judge of the 2014 Man Booker Prize. A former literary editor of the Times, her books include Ariel's Gift: Ted Hughes, Sylvia Plath and the Story of “Birthday Letters” and Seizure.

This article first appeared in the 25 May 2017 issue of the New Statesman, Why Islamic State targets Britain

0800 7318496