The work of cracking the genetic code in the 1960s was to understand the encryption of life. Photo: Getty
Show Hide image

Life itself is encrypted – but can you find the Easter eggs?

Art and science both had a long history of secret codes hidden in plain sight. Adam Rutherford goes on the hunt.

“To live, to err, to fall, to triumph, to recreate life out of life” – what a fitting sentiment to accompany the birth of a new organism. It’s a quotation from James Joyce’s Portrait of the Artist as a Young Man, and came as part and parcel with the creation of the first synthetic cell in 2010. Synthia – as it became known – was constructed by the scientist Craig Venter, who assembled its genetic code in a computer, and wheedled it into the chassis of an eviscerated cell, whereupon it became alive. The quotation, along with two others also encrypted in DNA, was buried in its genome.

Life itself is encrypted. DNA is the code – a set of instructions on how to build an organism. The work of cracking the genetic code in the 1960s was to understand the encryption of life. It did just that, as we now understand not just how genes work in living things, but how the rusting codes in our genomes betray our evolutionary history. Genes that were once vital are no longer, but leave coded shadows in our DNA.

Venter’s project was steganography – the art of hiding messages within another work. His motivation, I suspect, was partly hubris, but ostensibly to watermark the genome as manmade. But it comes from a long, fun, and seriously nerdy tradition that covers pretty much every cultural form. These messages are now more commonly known as Easter eggs, primarily from the hunts devised by programmers hiding treats in software. Many of us remember the excitement of discovering “the Hall of Tortured Souls” – a 3D adventure encoded by a disgruntled employee in Microsoft’s fairly rubbish Excel 95 spreadsheet, only accessible via a code in a particular cell. Video games are crammed with Easter eggs, and the race to find them is now standard practice. It suits the medium so well because the code itself is largely invisible and impenetrable to the user.

Easter eggs in music are legendary, frequently recorded backwards, or “backmasked”. The Beatles did it, Pink Floyd too. Play Jay Z’s track “Lucifer” backwards, and it may well say “666, murder murder Jesus”. Some satanic, some godly, these messages are mostly plain silly, but none more so than Ozzy Osborne’s on his track “Bloodbath in Paradise”, openly – secretly – mocking the devilish decrees of his metal brethren: “Your mother sells whelks in Hull.”

In books, recall, if you can, Kit Williams and his beautiful Masquerade. Published in 1979, every page contained a clue to the location of an 18-carat golden hare, which was buried under the shadow cast by a crucifix at midday on the autumn equinox. Novelist Ernie Cline launched a modern quest in his wickedly fun 2009 book Ready Player One – a tale of a global hunt to find three Easter eggs hidden in a huge future online world, the prize being ownership of the mega-billion dollar company. It’s irresistible to us of a certain age and geekiness, as the book is littered with references to 1980s video games and films such as Ghostbusters and Back to the Future. But what no one knew was that there was a real hunt in the book itself. It was claimed in 2011 – the prize: a Delorean.

In cinema, the practice is rife too. Each movie from the animation studio Pixar hides a character from their next film. The Toy Story films are weirdly laden with references to Stanley Kubrick’s horror The Shining, from the creepy iconic 1970s carpet, to the apposite name of a security camera in the Toy Story 3 – Overlook 237 – a reference to the Hotel, and its spookiest room. Even film posters are not immune to steganography. The one-sheet for Silence of the Lambs features the image of a skull on the back of a death’s head moth covering Jodie Foster’s mouth. Look carefully and you’ll see it’s actually composed of naked women – as indeed are the irises of the classic jazz-age cover of The Great Gatsby.

Books, DNA, films and Easter eggs: these are some of my favourite things. Which brings us to my book Creation. It was published in 2013, about the parallel sciences of origin of life research, and genetic engineering. I, like plenty of film nerds, have good recall for lines from movies. Simply for my own amusement, I always hide them in scripts, articles and books. Mostly these go unnoticed. Mostly. Creation has plenty, 20 at last count, some explicit, some merely a reference or paraphrase. In doing so, I had inadvertently hidden Easter eggs in a book in which I describe DNA Easter eggs. And thus the game was afoot. Creation is a book in two halves, and its gimmick is that both halves have their own cover, and are inverted, so you can read each from either direction. Many people asked me what happens in the middle of the paperback, to which the answer was, it contains the following text:

TTCTAGCTGCTGTAGTGGTAGAGGTACTGCACCTAGCTGGCC
GGCGTGAGCTGCGTGAACATCTGCGTGCTGGTGAGCTGCGCC
AACGACATCGACGTGAGC

Using a standard DNA cipher described in the book revealed that that code spelt out this:

CREATI.NATVKD.TPENGVINGR.VPD.TC.M

The encryption I used doesn’t have O or U in it, but, my presumption was that anyone sharp enough to translate it would spot the full stop ‘CREATI.N’ stood in for an O, and the V in PENGVIN stood in for a U, and thus realise that it is an email address. We put it out on Twitter, and the first email arrived an hour later. The people who wrote to it were directed to a website, which contained a video. That film was a mock of the denouement of the Usual Suspects, in which (spoiler alert) the plot is revealed to be almost entirely unreliable by clues on a notice board. In my appallingly acted version, the instructions were given to hunt down my own watermarks, homages, and games: three quotations buried in the text.

A week later, four winners had all claimed their prizes, a stack of books from Penguin. They all found a line from “Life on Mars” by David Bowie. Two identified a made-up word from The Simpsons, and one a made-up creature from The Princess Bride. But in total the winners only found eight. The official hunt is over, but can you do better? Start at the very beginning. It’s a very good place to start.

Adam Rutherford is the author of Creation which has been shortlisted for the Wellcome Book Prize 2014

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: “Playing God” (BBC2) as well as numerous other programmes for BBC Radio 4. Creation is his first book. It is shortlisted for the Wellcome Book Prize 2014.

Show Hide image

Why does food taste better when we Instagram it?

Delay leads to increased pleasure when you set up a perfect shot of your dinner.

Been on holiday? Take any snaps? Of course you did – but if you’re anything like me, your friends and family didn’t make it into many of them. Frankly, I can only hope that Mr Whippy and I will still be mates in sixty years, because I’m going to have an awful lot of pictures of him to look back on.

Once a decidedly niche pursuit, photographing food is now almost as popular as eating it, and if you thought that the habit was annoying at home, it is even worse when it intrudes on the sacred peace of a holiday. Buy an ice cream and you’ll find yourself alone with a cone as your companion rushes across a four-lane highway to capture his or hers against the azure sea. Reach for a chip before the bowl has been immortalised on social media and get your hand smacked for your trouble.

It’s a trend that sucks the joy out of every meal – unless, that is, you’re the one behind the camera. A new study published in the Journal of Personality and Social Psychology suggests that taking pictures of food enhances our pleasure in it. Diners at the food court of a farmers’ market in Philadelphia were asked either to photograph their meal or to eat “as you normally would”, then were questioned about how they found it. Those in the photography group reported that not only did they enjoy their meal more, but they were “significantly more immersed in the experience” of eating it.

This backs up evidence from previous studies, including one from this year in the Journal of Consumer Marketing, which found that participants who had been asked to photograph a red velvet cake – that bleeding behemoth of American overindulgence – later rated it as significantly tastier than those who had not.

Interestingly, taking a picture of a fruit salad had no effect on its perceived charms, but “when descriptive social norms regarding healthy eating [were] made salient”, photographing these healthier foods did lead to greater enjoyment. In other words, if you see lots of glossy, beautifully lit pictures of chia seed pudding on social media, you are more likely to believe that it’s edible, despite all the evidence to the contrary.
This may seem puzzling. After all, surely anything tastes better fresh from the kitchen rather than a protracted glamour shoot – runny yolks carefully split to capture that golden ooze, strips of bacon arranged just so atop plump hemispheres of avocado, pillowy burger buns posed to give a glimpse of meat beneath. It is hardly surprising that 95 million posts on Instagram, the photo-sharing site, proudly bear the hashtag #foodporn.

However, it is this delay that is apparently responsible for the increase in pleasure: the act of rearranging that parsley garnish, or moving the plate closer to the light, increases our anticipation of what we are about to eat, forcing us to consider how delicious it looks even as we forbid ourselves to take a bite until the perfect shot is in the bag. You could no doubt achieve the same heightened sense of satisfaction by saying grace before tucking in, but you would lose the gratification that comes from imagining other people ogling your grilled Ibizan sardines as they tuck in to an egg mayonnaise at their desk.

Bear in mind, though, that the food that is most successful on Instagram often has a freakish quality – lurid, rainbow-coloured bagel-croissant hybrids that look like something out of Frankenstein’s bakery are particularly popular at the moment – which may lead to some unwise menu choices in pursuit of online acclaim.

On the plus side, if a diet of giant burgers and salted-caramel lattes leaves you feeling queasy, take heart: if there is one thing that social media likes more than #avotoast, it is embarrassing oversharing. After a week of sickening ice-cream shots, a sickbed selfie is guaranteed to cheer up the rest of us. 

Felicity Cloake is the New Statesman’s food columnist. Her latest book is The A-Z of Eating: a Flavour Map for Adventurous Cooks.

This article first appeared in the 25 August 2016 issue of the New Statesman, Cameron: the legacy of a loser