The work of cracking the genetic code in the 1960s was to understand the encryption of life. Photo: Getty
Show Hide image

Life itself is encrypted – but can you find the Easter eggs?

Art and science both had a long history of secret codes hidden in plain sight. Adam Rutherford goes on the hunt.

“To live, to err, to fall, to triumph, to recreate life out of life” – what a fitting sentiment to accompany the birth of a new organism. It’s a quotation from James Joyce’s Portrait of the Artist as a Young Man, and came as part and parcel with the creation of the first synthetic cell in 2010. Synthia – as it became known – was constructed by the scientist Craig Venter, who assembled its genetic code in a computer, and wheedled it into the chassis of an eviscerated cell, whereupon it became alive. The quotation, along with two others also encrypted in DNA, was buried in its genome.

Life itself is encrypted. DNA is the code – a set of instructions on how to build an organism. The work of cracking the genetic code in the 1960s was to understand the encryption of life. It did just that, as we now understand not just how genes work in living things, but how the rusting codes in our genomes betray our evolutionary history. Genes that were once vital are no longer, but leave coded shadows in our DNA.

Venter’s project was steganography – the art of hiding messages within another work. His motivation, I suspect, was partly hubris, but ostensibly to watermark the genome as manmade. But it comes from a long, fun, and seriously nerdy tradition that covers pretty much every cultural form. These messages are now more commonly known as Easter eggs, primarily from the hunts devised by programmers hiding treats in software. Many of us remember the excitement of discovering “the Hall of Tortured Souls” – a 3D adventure encoded by a disgruntled employee in Microsoft’s fairly rubbish Excel 95 spreadsheet, only accessible via a code in a particular cell. Video games are crammed with Easter eggs, and the race to find them is now standard practice. It suits the medium so well because the code itself is largely invisible and impenetrable to the user.

Easter eggs in music are legendary, frequently recorded backwards, or “backmasked”. The Beatles did it, Pink Floyd too. Play Jay Z’s track “Lucifer” backwards, and it may well say “666, murder murder Jesus”. Some satanic, some godly, these messages are mostly plain silly, but none more so than Ozzy Osborne’s on his track “Bloodbath in Paradise”, openly – secretly – mocking the devilish decrees of his metal brethren: “Your mother sells whelks in Hull.”

In books, recall, if you can, Kit Williams and his beautiful Masquerade. Published in 1979, every page contained a clue to the location of an 18-carat golden hare, which was buried under the shadow cast by a crucifix at midday on the autumn equinox. Novelist Ernie Cline launched a modern quest in his wickedly fun 2009 book Ready Player One – a tale of a global hunt to find three Easter eggs hidden in a huge future online world, the prize being ownership of the mega-billion dollar company. It’s irresistible to us of a certain age and geekiness, as the book is littered with references to 1980s video games and films such as Ghostbusters and Back to the Future. But what no one knew was that there was a real hunt in the book itself. It was claimed in 2011 – the prize: a Delorean.

In cinema, the practice is rife too. Each movie from the animation studio Pixar hides a character from their next film. The Toy Story films are weirdly laden with references to Stanley Kubrick’s horror The Shining, from the creepy iconic 1970s carpet, to the apposite name of a security camera in the Toy Story 3 – Overlook 237 – a reference to the Hotel, and its spookiest room. Even film posters are not immune to steganography. The one-sheet for Silence of the Lambs features the image of a skull on the back of a death’s head moth covering Jodie Foster’s mouth. Look carefully and you’ll see it’s actually composed of naked women – as indeed are the irises of the classic jazz-age cover of The Great Gatsby.

Books, DNA, films and Easter eggs: these are some of my favourite things. Which brings us to my book Creation. It was published in 2013, about the parallel sciences of origin of life research, and genetic engineering. I, like plenty of film nerds, have good recall for lines from movies. Simply for my own amusement, I always hide them in scripts, articles and books. Mostly these go unnoticed. Mostly. Creation has plenty, 20 at last count, some explicit, some merely a reference or paraphrase. In doing so, I had inadvertently hidden Easter eggs in a book in which I describe DNA Easter eggs. And thus the game was afoot. Creation is a book in two halves, and its gimmick is that both halves have their own cover, and are inverted, so you can read each from either direction. Many people asked me what happens in the middle of the paperback, to which the answer was, it contains the following text:

TTCTAGCTGCTGTAGTGGTAGAGGTACTGCACCTAGCTGGCC
GGCGTGAGCTGCGTGAACATCTGCGTGCTGGTGAGCTGCGCC
AACGACATCGACGTGAGC

Using a standard DNA cipher described in the book revealed that that code spelt out this:

CREATI.NATVKD.TPENGVINGR.VPD.TC.M

The encryption I used doesn’t have O or U in it, but, my presumption was that anyone sharp enough to translate it would spot the full stop ‘CREATI.N’ stood in for an O, and the V in PENGVIN stood in for a U, and thus realise that it is an email address. We put it out on Twitter, and the first email arrived an hour later. The people who wrote to it were directed to a website, which contained a video. That film was a mock of the denouement of the Usual Suspects, in which (spoiler alert) the plot is revealed to be almost entirely unreliable by clues on a notice board. In my appallingly acted version, the instructions were given to hunt down my own watermarks, homages, and games: three quotations buried in the text.

A week later, four winners had all claimed their prizes, a stack of books from Penguin. They all found a line from “Life on Mars” by David Bowie. Two identified a made-up word from The Simpsons, and one a made-up creature from The Princess Bride. But in total the winners only found eight. The official hunt is over, but can you do better? Start at the very beginning. It’s a very good place to start.

Adam Rutherford is the author of Creation which has been shortlisted for the Wellcome Book Prize 2014

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: “Playing God” (BBC2) as well as numerous other programmes for BBC Radio 4. Creation is his first book. It is shortlisted for the Wellcome Book Prize 2014.

NANCY JO IACOI/GALLERY STOCK
Show Hide image

There are only two rules for an evening drink: it must be bitter, and it must be cold

A Negroni is the aperitif of choice in bars everywhere from London to Palermo - and no wonder.

The aperitif has the odd distinction of being the only alcohol that can always rely on a sober audience: it is the opener, the stimulant, a spur to the appetite for good food and good conversation. This preparatory beverage is considered the height of sophistication, and certainly nobody labouring in field or factory ever required a pep to their evening appetite. Still, to take a drink before one starts drinking is hardly clever behaviour. So why do it?

One reason is surely the wish to separate the working day from the evening’s leisure, an increasingly pressing matter as we lose the ability to switch off. This may change the nature of the aperitif, which was generally supposed to be light, in alcohol and character. Once, one was expected to quaff a pre-dinner drink and go in to dine with faculties and taste buds intact; now, it might be more important for those who want an uninterrupted meal to get preprandially plastered. That way, your colleagues may contact you but they won’t get much sense out of you, and pretty soon they’ll give up and bother someone else.

The nicest thing about the aperitif, and the most dangerous, is that it doesn’t follow rules. It’s meant to be low in alcohol, but nobody ever accused a gin and tonic or a Negroni (Campari, gin and vermouth in equal portions) of that failing; and sherry, which is a fabulous aperitif (not least because you can keep drinking it until the meal or the bottle ends), has more degrees of alcohol than most wines. An aperitif should not be heavily perfumed or flavoured, for fear of spoiling your palate, yet some people love pastis, the French aniseed drink that goes cloudy in water, and that you can practically smell across the Channel. They say the scent actually enhances appetite.

Really only two rules apply. An aperitif should be bitter – or, at any rate, it shouldn’t be sweet, whatever the fans of red vermouth may tell you. And it must be cold. Warm drinks such as Cognac and port are for after dinner. Not for nothing did Édith Piaf warble, in “Mon apéro”, about drowning her amorous disappointments in aperitifs: fail to cool your passions before sharing a table, and you belong with the barbarians.

On the other hand, conversing with your nearest over a small snack and an appropriate beverage, beyond the office and before the courtesies and complications of the dinner table, is the essence of cultured behaviour. If, as is sometimes thought, civilisation has a pinnacle, surely it has a chilled apéro carefully balanced on top.

The received wisdom is that the French and Italians, with their apéritifs and aperitivos, are the experts in these kinds of drinks. Certainly the latter are partial to their Aperol spritzes, and the former to such horrid, wine-based tipples as Lillet and Dubonnet. But the English are good at gin and the Americans invented the Martini. As for Spain, tapas were originally snacks atop a covering that kept the flies out of one’s pre-dinner drink: tapa means lid.

Everywhere, it seems, as evening approaches, people crave a drink that in turn will make them salivate: bitterness, the experts tell us, prepares the mouth to welcome food. The word “bitter” may come from “bite”, in which case the aperitif’s place before dinner is assured.

I like to think that a good one enables the drinker to drown all sour feelings, and go in to dinner cleansed and purified. Fanciful, perhaps. But what better lure to fancy than a beverage that exists only to bring on the evening’s pleasures?

Nina Caplan is the Louis Roederer Pio Cesare Food and Wine Writer of the Year

Nina Caplan is the 2014 Fortnum & Mason Drink Writer of the Year and 2014 Louis Roederer International Wine Columnist of the Year for her columns on drink in the New Statesman. She tweets as @NinaCaplan.

This article first appeared in the 22 September 2016 issue of the New Statesman, The New Times