The work of cracking the genetic code in the 1960s was to understand the encryption of life. Photo: Getty
Show Hide image

Life itself is encrypted – but can you find the Easter eggs?

Art and science both had a long history of secret codes hidden in plain sight. Adam Rutherford goes on the hunt.

“To live, to err, to fall, to triumph, to recreate life out of life” – what a fitting sentiment to accompany the birth of a new organism. It’s a quotation from James Joyce’s Portrait of the Artist as a Young Man, and came as part and parcel with the creation of the first synthetic cell in 2010. Synthia – as it became known – was constructed by the scientist Craig Venter, who assembled its genetic code in a computer, and wheedled it into the chassis of an eviscerated cell, whereupon it became alive. The quotation, along with two others also encrypted in DNA, was buried in its genome.

Life itself is encrypted. DNA is the code – a set of instructions on how to build an organism. The work of cracking the genetic code in the 1960s was to understand the encryption of life. It did just that, as we now understand not just how genes work in living things, but how the rusting codes in our genomes betray our evolutionary history. Genes that were once vital are no longer, but leave coded shadows in our DNA.

Venter’s project was steganography – the art of hiding messages within another work. His motivation, I suspect, was partly hubris, but ostensibly to watermark the genome as manmade. But it comes from a long, fun, and seriously nerdy tradition that covers pretty much every cultural form. These messages are now more commonly known as Easter eggs, primarily from the hunts devised by programmers hiding treats in software. Many of us remember the excitement of discovering “the Hall of Tortured Souls” – a 3D adventure encoded by a disgruntled employee in Microsoft’s fairly rubbish Excel 95 spreadsheet, only accessible via a code in a particular cell. Video games are crammed with Easter eggs, and the race to find them is now standard practice. It suits the medium so well because the code itself is largely invisible and impenetrable to the user.

Easter eggs in music are legendary, frequently recorded backwards, or “backmasked”. The Beatles did it, Pink Floyd too. Play Jay Z’s track “Lucifer” backwards, and it may well say “666, murder murder Jesus”. Some satanic, some godly, these messages are mostly plain silly, but none more so than Ozzy Osborne’s on his track “Bloodbath in Paradise”, openly – secretly – mocking the devilish decrees of his metal brethren: “Your mother sells whelks in Hull.”

In books, recall, if you can, Kit Williams and his beautiful Masquerade. Published in 1979, every page contained a clue to the location of an 18-carat golden hare, which was buried under the shadow cast by a crucifix at midday on the autumn equinox. Novelist Ernie Cline launched a modern quest in his wickedly fun 2009 book Ready Player One – a tale of a global hunt to find three Easter eggs hidden in a huge future online world, the prize being ownership of the mega-billion dollar company. It’s irresistible to us of a certain age and geekiness, as the book is littered with references to 1980s video games and films such as Ghostbusters and Back to the Future. But what no one knew was that there was a real hunt in the book itself. It was claimed in 2011 – the prize: a Delorean.

In cinema, the practice is rife too. Each movie from the animation studio Pixar hides a character from their next film. The Toy Story films are weirdly laden with references to Stanley Kubrick’s horror The Shining, from the creepy iconic 1970s carpet, to the apposite name of a security camera in the Toy Story 3 – Overlook 237 – a reference to the Hotel, and its spookiest room. Even film posters are not immune to steganography. The one-sheet for Silence of the Lambs features the image of a skull on the back of a death’s head moth covering Jodie Foster’s mouth. Look carefully and you’ll see it’s actually composed of naked women – as indeed are the irises of the classic jazz-age cover of The Great Gatsby.

Books, DNA, films and Easter eggs: these are some of my favourite things. Which brings us to my book Creation. It was published in 2013, about the parallel sciences of origin of life research, and genetic engineering. I, like plenty of film nerds, have good recall for lines from movies. Simply for my own amusement, I always hide them in scripts, articles and books. Mostly these go unnoticed. Mostly. Creation has plenty, 20 at last count, some explicit, some merely a reference or paraphrase. In doing so, I had inadvertently hidden Easter eggs in a book in which I describe DNA Easter eggs. And thus the game was afoot. Creation is a book in two halves, and its gimmick is that both halves have their own cover, and are inverted, so you can read each from either direction. Many people asked me what happens in the middle of the paperback, to which the answer was, it contains the following text:

TTCTAGCTGCTGTAGTGGTAGAGGTACTGCACCTAGCTGGCC
GGCGTGAGCTGCGTGAACATCTGCGTGCTGGTGAGCTGCGCC
AACGACATCGACGTGAGC

Using a standard DNA cipher described in the book revealed that that code spelt out this:

CREATI.NATVKD.TPENGVINGR.VPD.TC.M

The encryption I used doesn’t have O or U in it, but, my presumption was that anyone sharp enough to translate it would spot the full stop ‘CREATI.N’ stood in for an O, and the V in PENGVIN stood in for a U, and thus realise that it is an email address. We put it out on Twitter, and the first email arrived an hour later. The people who wrote to it were directed to a website, which contained a video. That film was a mock of the denouement of the Usual Suspects, in which (spoiler alert) the plot is revealed to be almost entirely unreliable by clues on a notice board. In my appallingly acted version, the instructions were given to hunt down my own watermarks, homages, and games: three quotations buried in the text.

A week later, four winners had all claimed their prizes, a stack of books from Penguin. They all found a line from “Life on Mars” by David Bowie. Two identified a made-up word from The Simpsons, and one a made-up creature from The Princess Bride. But in total the winners only found eight. The official hunt is over, but can you do better? Start at the very beginning. It’s a very good place to start.

Adam Rutherford is the author of Creation which has been shortlisted for the Wellcome Book Prize 2014

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: “Playing God” (BBC2) as well as numerous other programmes for BBC Radio 4. Creation is his first book. It is shortlisted for the Wellcome Book Prize 2014.

Getty
Show Hide image

Drama without sensation: A Separation is an unsettling novel of distances

In Katie Kitamura’s novel, it is the distance between the narrator’s two selves that causes her most discomfort.

In a 2013 interview with Guernica, the online magazine, the novelist Katie Kitamura discussed how publishing’s “deeply patronising attitude” towards female readers results in overtly feminine book covers, featuring, for instance, women in bathing suits. “That’s not the kind of book cover that makes me want to buy a book,” she said.

The cover of Kitamura’s latest novel, A Separation, does, surprisingly, feature a woman in a bathing suit. But there is something quietly unsettling about this picture: the woman, who has her back to us, is awkwardly cropped out of frame from the elbows up, and she is sitting at the edge of an oddly shaped pool. Most of the cover is solid turquoise – a bright wash of negative space.

Kitamura’s unnamed narrator is a poised literary translator. As the novel opens in London, we learn that she is married to Christopher (a charming, haphazard non-author) but, in secret, they have been living separately for the past six months. When she receives a telephone call from Christopher’s mother, Isabella, informing her that he has seemingly gone missing in Greece, she doesn’t let on about her disintegrating marriage but boards a plane to look for him.

Much of the rest of the novel takes place in Greece: at a “very pleasant” hotel, in “perfect weather”, the pool “heated to a very comfortable temperature”. The area has recently experienced a string of devastating fires, leaving patches of scorched earth. The location has an almost eerie surface stillness that jars with the mystery at its heart. In this way, Kitamura (an art critic as well as novelist) creates a setting somehow reminiscent of David Hockney’s A Bigger Splash, Christopher’s sudden disappearance leaving behind no visible ripples.

The narrator, too, has a glassy composure at odds with the tumultuous events. On deciding to end her marriage formally, she shows neither despair nor relief, but anxiety about the etiquette. “I assumed – I had no prior experience to go on – that asking for a divorce was always discomfiting,” she says with typical understatement, “but I could not believe it was always this awkward.” Of her feelings for her new partner, Yvan, she notes that they seem more like “administration rather than passion”, and then offers a moderated gloss of Hamlet, “You cannot say you did it out of love, since at your age romantic passions have grown weak, and the heart obeys reason.

Her emotional separation from the trauma of her circumstances allows the narrator to examine the facts of her husband’s disappearance. She knows Christopher was unfaithful and she immediately identifies the hotel receptionist as the object of his attentions. We never see the narrator professionally translating, but the novel is concerned with her attempts to read the deeper meanings behind the remarks and behaviour of those around her. She finds it easy to imagine unseen contexts to conversations: an argument between Christopher’s parents, an embrace between her taxi driver and the hotel receptionist. As she writes, “Imagination, after all, costs nothing.”

Her propensity for projection is such that some things remain lost in translation. Even the most minute interactions can be misread. When Christopher’s mother comments that the two women’s love for her son connects them, “she was looking over my shoulder, as if watching someone approach . . . she was staring at nothing”. The novel occupies this imaginative negative space: the gap between what people think and how they appear.

Ultimately, it is the distance between the narrator’s two selves that causes her most discomfort. How long will she allow others to read her as the concerned, loving wife? Should she admit she wants to find Christopher in order to request that they separate officially? As her search continues she notes, “There was a small but definite wedge pushing between the person I was and the person I was purporting to be.”

There is a suspenseful and menacing tone to Kitamura’s prose that might trick a reader into thinking, at first, they are in the territory of thrillers such as Gone Girl and The Girl on the Train. Both these novels, like A Separation, have narrators who defy readers’ attempts to fathom their emotional depths and to deal with questions of how well you know anyone – even your own partner. But this is a work free of sensation, or even resolution. As the narrator notes, in the shock of an event it is natural to look for a more dramatic narrative. “But in the end,” she says, “this is only chasing shadows. The real culpability is not to be found in the dark or with a stranger, but in ourselves.”

A Separation by Katie Kitamura is published by Clerkenwell Press (231pp, £12.99)

Anna Leszkiewicz is a pop culture writer at the New Statesman.

This article first appeared in the 23 March 2017 issue of the New Statesman, Trump's permanent revolution