<![CDATA[Culture]]> <![CDATA[On ghosts, or why I never want to be anybody’s muse]]> Sometimes I occupy beds that ghosts visit.

There was a strong and pathetic need in me up until a few years ago to become someone’s muse. Whether you think of yourself as a feminist woman or not, sometimes it’s hard to get away from the fact that your role has already been predestined, written in curling, delicate hand about Lord Byron, chiselled into stone somewhere, Edie Sedgwick and her ilk lie in ecstasy in the background of some dark, violent party of the mind, the reason the men are there, but the muses are not the centre of conversation, and yes, they are the glamorous, seductive type you are drawn to. You can’t stop thinking of yourself as the romantic figure, floating in and out of heroes’ lives, a Jane Eyre or another long-suffering woman who is foregrounded in your head but just lives to lend all the ideas you have about the world to another, because they seem to have a firmer hand, a choking grasp on life you do not, because you’ve seen it happen before, and it will happen again. There’s no song lyric “men are doing it for themselves”, well, because, nothing so obvious is ever written down and paid attention to. A blackened part of me understands that there are thousands of voices of women in the chasm of history who only ever spoke through the voices of the men they fell in love with. Some of the greatest works of our time would be even finer if they had been written by the hand who first had the idea.

The only antidote to this is to really pay attention to how utterly fragile talent is when contained within the human body. It is certainly not robust enough to be kept in only men. You stay around anyone you admire for their games or art or writing for long enough and you’ll understand that they are awful in some incredibly profound way, and if they aren’t awful they are a nice person who is broken and cut up in ways that it will hurt to think about.

I’ve spoken a lot with the game designer and writer Harvey Smith recently about whether having a privileged background or upbringing helps a person produce better art, or whether having a difficult life helps produce better art (Harvey has a wealth of stories about his background that would make you think the latter). I concluded that when you don’t have things like social ostracisation, war, poverty or sickness in your way, it’s much easier to make things faster, which is probably why middle-class white dudes produce such a vast array of our art. There’s a better hit rate, y’know? And it’s not necessarily that broken people make better art, though perhaps sometimes the ability to communicate pain helps. I don’t believe you have to be beaten down by society to make something profound. You just have to be able to produce it, and that’s the hard part. The hard part is telling yourself you are that person. The person who makes.

There’s something Harvey said recently that really sticks with me, and it’s this wonderful little moment in time in my head. Writers have a real talent for articulating exactly what you didn’t know you thought before, and he said, sitting on the arm of the couch, looking up at me in the loft of his and Leah’s beautiful Lyon apartment, “The hardest part is admitting you want to do it. Saying, I want to be a games designer, or a writer, or anything creative.”

It took me about twenty-seven years, most of them during which I was writing fiction, poetry or criticism, to realise that I was a writer, and that I wanted to be a writer, and that I was a writer who was good enough. I didn’t want to be around people who create things. I didn’t want to be with them. I was already one of them. Why was I wasting time? You do not get to write my story. I write it. I write it myself. Stealing is only legitimate if it’s mutual. There does not get to be a one way road any more. I am no one’s muse because I have the ideas. They are mine.

Perhaps I am fucked up, awful in some incredibly profound way, and if I’m not awful I might be a nice person who is broken and cut up in ways that will hurt for others to think about. Perhaps I am that person that men look at and think, I wish I was her muse, though the canon for some sort of male muse is somewhat absent. None of it really matters to me now, because I understand that talent is fragile and that even trying to articulate it now may be killing any talent I had left.

Right now as I am travelling through France I realise that I have the firmest choke hold on life I have ever had. I do not need the ghosts that I once summoned to my bed: those ghosts that I once thought, perhaps the creativity of life will touch me through them and I will feel good again. Those ghosts that I used to think: they are the only romantic thing about my life. The ones I let go, the ones I could never have, the people who did not respect or love me, the people who slipped through my fingers, or laughed when someone said, “She’s a writer. Sort of.” The ghosts who will watch you sleep and when you wake you are covered in a thousand cuts. The ghosts who whisper hoarse in the dark, they used to say, “You should have asked me to marry you.”

I slit all their throats. And when I occupy a bed with another person who has those ghosts, I can shake the ghosts’ hands and say, I know you, and I have sympathy for you. But you are not welcome. I am waiting for the day this person kills you.

. . . I’ll come back on that day.

This article first appeared on caraellison.co.uk and is crossposted here with permission

]]>
<![CDATA[Why do our offices make us so miserable?]]> Cubed: A Secret History of the Workplace
Nikil Saval
Doubleday, 2014

Five days a week I commute to a skyscraper in the main business district of a large city and sit at a desk within whispering distance of another desk. Whatever the word “work” used to conjure, my version is now quite standard. About 40 million Americans make a living in some sort of cubicle. 

Are we happy about that? The likelihood that we are not is central to Nikil Saval’s impressive debut, Cubed: A Secret History of the Workplace. He begins with a description of a viral video purporting to show a spontaneous case of cubicle rage – “purporting” because it may have been a hoax – and lingers on the famous scene from Office Space in which three frustrated employees destroy a fax machine. Having proven his cultural bona fides, Saval explicitly positions Cubed as a pop-modern version of C Wright Mills’s 1951 White Collar: The American Middle Classes, a sociological text that took a dim view of non-manual labor as tedious and isolating.

Strictly speaking, Cubed is a history of the office, not office-worker unhappiness. Saval assumes, probably correctly, that offices are ubiquitous to the point of invisibility. Like the young fish in David Foster Wallace’s Kenyon commencement speech – the one who asks: “what the hell is water?” – we are too familiar with our surroundings to bother wondering about them.

Yet as Saval bothers, situating the office in historical perspective, he emphasises the experience of average workers over those who have ascended to management, and returns again and again to the theme of disgruntlement.

At times he does so out of a descriptive impulse to tell it like it is. On other occasions he plays the role of an activist, prodding us to wake up to our malaise so that we might finally do something about it. He ultimately welcomes the technological and macro-economic changes that could make traditional offices unnecessary because he holds, a little too strongly, to the notion that the white-collar work environment is itself to blame for white-collar dissatisfaction.

ADVERTISEMENT

***

The modern office emerged from the “counting houses” of the mid-nineteenth century, and white-collar workers emerged as a class along with it. Back then we called ourselves “clerks” rather than “knowledge workers” and spent our time keeping books for merchants, lawyers, or bankers.

Counting houses were cramped: one typical New York establishment was only 25 square feet yet accommodated four partners and six clerical workers. They were also hopeful. In part because we were so physically close to our employers, we were convinced that we would eventually take their places. For this reason, we thought we were exempt from the Marxist principle that capital and labor are locked in an intractable conflict. Less clinically: We felt justified in rooting for our employers’ success. We saw ourselves “shaking hands” with our bosses instead of shaking fists.

Perhaps fellowship really did exist in the counting-house era. But as time went on, employers took more interest in making us more productive than in bringing us along. Of course we weren’t necessarily cognisant of that fact.

In the early twentieth century, the Larkin Company, a soap manufacturer turned mail-order operation, hired Frank Lloyd Wright to design a state-of-the-art headquarters in Buffalo, New York. Its most distinctive feature was a central court with a metal-and-glass roof that let in natural light for the whole building, and which doubled as an administrative space.

Although the Larkin building was, in a sense, an upgrade over the dingy warrens where we’d toiled before, it was also sinister. In the central court sat rows “of identically attired and coiffured women together in a visual line, guarded at the desk corners by four male executives.” These execs were watching us. The building was “designed for easy supervision and surveillance.”

All that light made us think the company wanted to “take care” of us, as one Larkin secretary put it. Hidden by the glare was the reality that “the numbing work remained the same,” and that managers were constantly spying to make sure the numbing work was completed as efficiently as possible.

Designers have since attempted to make work environments less oppressive, but have generally succeeded only in making things worse. In 1964, the manufacturer Herman Miller unveiled Robert Propst’s Action Office, a “proposition for an altogether new kind of space” that was “about movement” rather than “keeping people in place.” Propst imagined us in “work stations” with two different desks – one for standing, one for sitting – a mobile table for meetings and an acoustically insulated telephone dock (something like a three-sided telephone booth).

When these didn’t sell, Propst tried again with Action Office II. He shrank our stations and surrounded them with three walls made of disposable materials, which we could theoretically arrange to create whatever kind of space we wanted. He gave us tackboards for “individuation”. Sound familiar? He’d invented the cubicle.

Employers loved Propst’s invention, which was cheaper than more traditional furniture. But George Nelson, who had worked with Propst on Action Office I, anticipated their dehumanizing effect. Action Office II “is definitely not a system which produces an environment gratifying for people in general,” he wrote. “It is admirable for planners looking for ways of cramming in a maximum number of bodies, for ‘employees’ (as against individuals), for ‘personnel,’ corporate zombies, the walking dead, the silent majority.”

In the era of the cubicle, the hope of the counting house days felt distant indeed. Not only were we confined in disposable pens, but we were overeducated, and our “expectations were gradually running up against [our] actual possibilities for advancement.” At least we had job security—until of course we didn’t. By the 1980s we were targets for downsizing. “Between 1990 and 1991, 1.1 million office workers would be laid off, exceeding blue-collar layoffs for the first time.” The modern office “asked for dedication and commitment,” but we were offered “none in return”.

Our bosses weren’t blind to our unhappiness and tried, as Propst had tried, to shake things up. There were stunts: Andrew Grove, the Intel C.E.O., played at nurturing an egalitarian culture by sitting at a cubicle. This was “a gesture of pure irony” because “you could hardly be said to occupy a cubicle if you could leave whenever you pleased, probably spent most of your working hours flying around the country in the company jet, and earned $200m a year.”

And there were earnest attempts at improvement that felt like stunts. In 1993, Jay Chiat of the advertising agency Chiat/Day resolved to “de-territorialise” the office by getting rid of the “walls, desks, and cubicles,” the “desktop computers and the phones”. He thought this would help us focus on work rather than office politics, but it only caused confusion. “People arrived and had no idea where to go, so they left. If they stayed, they found there was nowhere to sit; there were too many people.” We “began playing hooky” and managers couldn’t find us. “No work was getting done.”

In the twenty-first century, tech companies shower us with perks. At Google's Mountain View campus we get free food, a gym, day care, health and dental services, and a resistance pool. Less naïve than in the Larkin days, it’s not lost on us that as companies cater to our needs, they’re trying to do more than make us happy: they’re trying to keep us at work as long as possible, and away from their rivals.

Which isn’t to say that we’ve evolved into a different species since the Larkin building, or even the counting house. Saval emphasises certain traits that tie together office-workers past and present: Simultaneous frustration with and devotion to our employers; an aptitude for ignoring mistreatment; an inability to impress upon our bosses that they should probably consult us when making design and human resources decisions that affect our daily lives.

***

Saval is of course aware that he’s telling the story of the office at a moment when it’s in flux. Personal computing and the internet have made telecommuting feasible and the freelance economy is growing, so that many people who would have labored in a cubicle a generation ago now do their jobs at home or in coffee shops. Careful not to glorify contract labor, Saval concedes that many freelancers have not chosen to leave the permanent workforce: they’ve been pushed out. They don’t have benefits and may struggle for cash.

Still he accepts the precarious life of the freelancer as preferable to that of the old-fashioned cube-dweller. He criticises “organisations that insist on hierarchy” and praises “the willingness of workers to discard status privileges like desks and offices”.

In predicting that the old career path “from the cubicle to the corner office” is “coming to a close, and that a new sort of work, as yet unformed, is taking its place,” he finally allows himself to sound less like an impartial chronicler than a revolutionary. “It remains for office workers to make this freedom meaningful,” he writes, “to make the ‘autonomy’ promised by the fraying of the labor contract a real one, to make workplaces truly their own”.

Notice the way Saval balances the visual metaphor of the cube-to-corner career path against the abstract notion of new sort of career? In both descriptive and exhortative passages, he muddies the distinction between the misery of work, and the misery of the physical workplace, investing the latter with so much power that it overtakes the former as the true cause of white-collar distress. That’s why Saval finds restorative potential in the office-less future – and why I doubt it will live up to his expectations.

In his introduction, Saval cites a survey by the furniture company Steelcase, which found that 93 per cent of people who work in cubicles “would prefer a different workspace”. That’s not terribly surprising but also not terribly enlightening. Would a comparable percentage of people who work in retail, or in factories, or auto dealerships, or industrial farms prefer a different workspace? More pertinent: would we prefer different work – an entirely different job?

As mentioned, Saval smartly observes that after Larkin moved its employees into its state-of-the-art headquarters, “the numbing work remained the same.” And he suggests that white-collar laborers have often failed to acknowledge the fact of our exploitation. If we leave the cubicle only to bore ourselves at the coffee shop, we will still face exploitation, and dissatisfaction, too.

Juliet Lapidos is an editor at The New York Times. Follow her @julietlapidos.

This article first appeared on newrepublic.com

]]>
<![CDATA[Karl Ove Knausgaard: “The greatest sign of spring of all was the smell of burning grass”]]>

Image: Laura Carlin

Spring came to the housing dev­elopment, and with it came lightness: one day I put on my new sneakers, and to run out in them, after having stomped around in boots and heavy winter shoes for six months, felt pretty much like flying. The quilted trousers and down jackets which made all movement so cumbersome and ungainly were replaced by light trousers and jackets. Mittens, scarves and caps were put away. Skis and skates and sleds and toboggans were stored in basements and garages, bicycles and footballs were brought out, and the sun, which had hung low in the sky for so long, and whose rays had then been only for the eye, rose higher and higher, and soon became so warm that the jackets we put on in the morning had been stuffed into our backpacks by the time we came home from school at midday.

But the greatest sign of spring of all was the smell of burning grass that spread all over the housing development during these weeks. The cool evenings, the bluish dark, the cold which rose from the ditches that were still filled with snowdrifts, hard as ice and with gravel embedded in them, the steady hum of children’s voices, playing outside, some running after a ball on the road, others bicycling up and down ditches or rearing up on the sidewalk, all of them bubbling with life and lightness, for you were suddenly free to run, to bicycle, to shout, to laugh, and always in your nostrils there was the stinging yet rich smell of last year’s withered grass burning, which was suddenly everywhere. Once in a while we would run up and watch; the low, dense flames resembled orange waves, almost moist in the intensity of colour brought on by the evening dusk, guarded by a proud mother or father, often with the handle of a rake over their shoulder and gloves on their hands, like an order of knights of the lower middle class.

What was it about fire?

It seemed so alien here, it was so deeply archaic that nothing about it could be associated with the surroundings it appeared in: what was fire doing next to Fredriksen’s camper? What was fire doing next to Tone-Lill’s toy excavator? What was fire doing next to Hansen’s waterlogged, sun-bleached garden furniture?

In every shade of yellow and red, it stretched towards the sky, devoured crackling branches of pine, melted sputtering plastic, flared up here, then there, in completely unpredictable patterns, as beautiful as they were incredible, for what were they doing here, in our midst, among ordinary Norwegians on these ordinary 1970s evenings?

Another world appeared with the fire, and vanished with it. It was the world of water and air, earth and mountain, sun and stars, clouds and sky, the ancient world which was always there and always had been, and which one never thought about. But fire came, you could see it. And once you had seen it, you couldn’t help seeing it everywhere, in all fireplaces and ovens, in all factories and manufacturing plants, and in all the cars driving around on the roads, parked in garages or outside the houses in the evenings, for the fire burned in them, too. Even the cars were deeply archaic.

This vast age was really in everything, from the houses, which were of brick or wood, to the water which flowed in and out of them through pipes, but since everything happens as if for the first time with every generation, and since this generation had broken with the preceding one, this had been pushed to the back of consciousness, if it was there at all, for in our minds we were not just modern 1970s people, but our surroundings were modern 1970s surroundings. And our emotions, the feelings which coursed through every one of us in the neighbourhood on these spring evenings, were modern emotions. And for us, being children, that meant no history. Everything happened for the first time. That even our feelings were old was something we never considered. Why would we? The feelings which flowed through our chests, which made us shout and scream, laugh and cry, were just us, the way we were, just as the fridge had a light that lit up when the door was opened, or the houses had doorbells which rang when someone pressed the button.

Forty years later I sit here watching the arrival of another spring. Outside the window the lawn is green, in the flower beds thick, juicy tulip and lily-of-the-valley leaves are sprouting, and the trees are full of hard buds ready to unfold on the first warm day. Spring arrives, but it no longer brings any secrets, no longer holds any surprise, it unfolds mechanically, the thick covering of pale blue flowers spreading under the pear tree spread there last year too, and the year before, and the year before that. And the last time I experienced a new emotion, the last time I had a feeling I had never had before, was in 1985, when I was 16. It is while we are children and youths that we are wide open to the world, that is when we take in everything in it greedily, and what we gain and experience then, what we see and feel then, is something we spend the rest of our lives administering. But once in a while something manages to pierce this familiarity, to rip it open, as it were, and suddenly we see the world as it is in itself, mysterious, alien, mute. This is what used to be called the sublime, what Joyce called the epiphanic, and we all know it: how the moment suddenly has a weight of its own, and seems to tear itself loose from all other moments, so that an almost wild sensation of being right here, right now, arises.

It is a revelation. In the Bible, revelation often comes in the shape of fire, which is not so strange, since both the sacred and fire appear suddenly, perfect and immutable, and just as suddenly vanish.

On the final day of April last year, I was standing with maybe 40 other people out in a field in the far south of Sweden, under a starlit sky, facing an enormous bonfire. It was Walpurgis Night, which in Sweden means that people gather around bonfires throughout the country and sing in welcome of spring. The archaic nature of this ritual, which seems almost pagan, should be an impossibility in Sweden, which is perhaps the most politically correct and progressive country in the world, but there we stood, facing the crackling and booming fire, which flung flames and smoke and little black particles into the black sky, while our children ran around excited and out of breath, shouting and screaming and laughing, for spring had arrived, filled with lightness, light and a flood of unaccustomed emotions.

I stood in a line to buy them hot dogs and sodas, it was cold, and the trivial look of the ketchup and mustard bottles, the limp hot dogs, the folding table on which the soda bottles had been ranged, gave me a feeling of standing in a banal world and looking into a magical one, as if our lives are played out on the border between two parallel universes. That we begin in the magical, the world of bonfires and stars, the boisterous and entrancing world of spring, but without realising it, since there is no time with which to measure in it, and gradually slip into the world of limp hot dogs and rickety folding tables, where we settle down, and now and again, aided by bonfires and poetry, gaze into the unchanging, where the return of spring and the blanket of blue flowers under the pear tree is a revelation.

Written for the New Statesman, this essay was translated from the Norwegian by Ingvild Burkey

Karl Ove Knausgaard’s latest book is “Boyhood Island” (Harvill Secker, £12.99)

]]>
<![CDATA[Val McDermid’s Northanger Abbey and the struggle to breathe new life into Jane Austen]]> Northanger Abbey
Val McDermid
Borough Press, 352pp, £18.99

It is an odd thing, the so-called “Austen Project”. The idea, dreamt up by some clever operative at HarperCollins, is that a well-known novelist produce a contemporary version of each of Jane Austen’s six novels. You can imagine the growing excitement in the marketing department: each volume would catch both the contemporary author’s loyal readers and all those Austen fans. Better still, the series could hook some of those who have enjoyed Austen on the screen but who might find early-19th-century prose too daunting. Joanna Trollope has already “done” Sense and Sensibility; now the crime writer Val McDermid, doyenne of tartan noir, gives us her version of Northanger Abbey, transposed to some kind of present day.

The heroine is the callow, lovable Cat Morland, taken by friends of her parents not to Regency Bath but to contemporary Edinburgh, during the festival (so there are still assembly rooms and balls and Georgian façades). Henry Tilney, whom she falls for, is a young lawyer rather than a vicar; Johnny Thorpe, who assumes she will fall for him, is an obnoxious young City type. And so on. But, as in Trollope’s Sense and Sensibility, the narrative follows its original – episode by episode, dialogue for dialogue – very dutifully. We know it must be contemporary because there is a very large number of text messages and references to Cat’s interest in Facebook, but the structure is all Austen’s until a twist at the very end. In the original novel, General Tilney cruelly throws Catherine out of his house when he discovers that she is not the heiress he supposed. In this updating, he is given a more modern (and purely bigoted) reason for turning against her.

It is what used to be called an “imitation”: an updating that is supposed to be all the more pleasurable if you know the original. Yet, in successful instances, the point is as often the deviation from the original as the replication of it. That blissful cinematic imitation of Austen’s Emma, Clueless, is delightful because it improvises its analogies. In Beverly Hills, the thoroughly cool latter-day Frank Churchill character, who loves shopping and looks like a perfect partner for a chic girl, is unavailable because . . . he is gay. Of course!

Readers will find few of the pleasures of deviation in McDermid’s novel, but, if they know their Austen, will keep knowing exactly what is going to happen. And in one respect the old story is hard to update. When Northanger Abbey was published in 1818, the year after Austen’s death, it was with her prefatory note explaining, somewhat sheepishly, that it had been written 13 years earlier and featured “books, and opinions” that had since become “comparatively obsolete”. Composed as a jeu d’esprit when Austen was in her twenties, it preserved the satire on Gothic fiction for which she was now apologising.

It is just this satire that McDermid finds trickiest. You might think that such an accomplished crime writer would relish finding a contemporary equivalent for Catherine Morland’s conviction that she has stumbled on a murder mystery. Austen’s heroine has fed her imagination with Anne Radcliffe’s novels; McDermid’s reads the Twilight novels and a series called Hebridean Harpies, which includes such gems as Vampires on Vatersay and Banshees of Berneray. Compared to these, Radcliffe seems positively Tolstoyan. McDermid is having fun, of course, but her narrative task unfortunately requires her to show that these tales have taken possession of her otherwise delightful heroine’s untutored imagination.

We must believe she could fancy that the stiff, peremptory Falklands veteran General Tilney, who looks “amazingly young”, therefore just might be a vampire. After all, there don’t seem to be many mirrors in the house. Tilney mère is supposed to have died of leukaemia four years earlier, but young Cat “couldn’t help a tiny niggling voice in the back of her head muttering about bad blood and vampires”. Perhaps Mrs Tilney is a prisoner in one of the towers of the former abbey in the Scottish Borders that is the Tilney home? Or perhaps her husband murdered her? Or are the Tilneys a whole family of the undead? Cat may be a callow teenager from deepest Dorset but her delusions are as incredible as they are indistinct.

Austen’s novel is a witty parable about the uses of the imagination; McDermid’s determinedly sportive retelling does not have enough belief in the parable to breathe new life into it.

John Mullan is a professor of English at University College London and the author of “What Matters in Jane Austen?” (Bloomsbury)

]]>
<![CDATA[One Born Every Minute is the opium of the masses]]> OK, OK, so we all know that Made in Chelsea and The Only Way is Essex aren’t actually depicting the reality of life in Chelsea or Essex, but there’s something about medical reality TV programmes that somehow makes you think what you’re seeing is real. Channel 4’s Bafta-winning documentary series One Born Every Minute (OBEM) has recently returned to our screens for a fifth series. While its popularity is partly rooted in a certain voyeurism, many women (myself included), have watched it in the run up to childbirth in the hope of learning something of what was to come. After all, it’s a documentary, and though edited, isn’t scripted or staged. The care is real. The cleanliness, the calm, the almost ideological commitment to the profession, are all a true reflection of what our maternity units are like. . . right?

Like millions of you, I’ve tuned in to watch the messy business of childbirth. I’ve watched aghast as devoted midwives stay on past their shift to see through the labour of a woman whom they were so attentive to, you’d be forgiven for thinking they were long-lost friends. In one episode, they actually were! In more precarious situations, hoards of impeccably timed, rigorously diligent and profoundly empathetic midwives work in perfect harmony to support women, as if they were mythical angels of midwifery. The rose-tinted atmosphere is heightened by personal narratives from the midwives, who often talk about their profession as a dream vocation. While I don’t doubt many midwives do enter the profession thanks to vocational aspirations, statistics also tell us that midwives are leaving the profession in droves, suggesting that “tea and cake interspaced by miraculous experiences” might not be an entirely accurate portrayal of what their working lives are like.

For me, OBEM was a window – or so I thought – into the type of care I could expect to receive on the NHS. I wish I could confirm that the series offers an accurate depiction of the type of care you can expect to receive as an expectant mother, because frankly, it is exactly the level of care women should be receiving. And for many health professionals, it is precisely the type of care they wish they could deliver. But both my personal experience and crucially a range of figures, suggest otherwise.

One can safely assume that the maternity wards that agree to be filmed are not those struggling with staff shortages or overcrowding problems, as many of our maternity wards currently are. But I’ve come to wonder whether OBEM doesn’t actually act as a sort of pacifying decoy where there might otherwise be mass indignation as to what is truly happening in our hospitals.

The programme has aired over a period during which NHS restructuring means many maternity units are being downgraded or even shut down because of staff shortages and overcrowding. According to a recent survey, new mothers describe maternity units as “severely understaffed “with “overworked staff” on postnatal wards in particular. More than half of birthing units are not meeting the staffing guidelines set out by the Royal College of Obstetricians and Gynaecologists and a third of mums in labour are now being turned away from wards, a scene we have so far seen only once on the last season of OBEM! The Royal College of Midwives is campaigning for 5,000 more midwives to be recruited to meet growing demand and speaking last year its chief executive Cathy Warwick warned: “We are many thousands of midwives short of the number needed to deliver safe, high-quality care.”

In the series, we watch as consistently composed midwives with all the time in the world tend compassionately to labouring women in state-of-the-art facilities. And yet meanwhile, many of us experience a system in which overworked and over-stretched midwives struggle to meet requests beyond the barest essentials. And who can blame them when, unlike the midwives on OBEM who seem to enjoy endless tea breaks, the midwives who don’t make it onto our screens report that missing meal breaks and finishing shifts late is a daily occurrence. As one midwife confessed to me: “One Born Every Minute is about as similar to my experience of being a birth centre midwife as Green Wing is to working in a hospital.”

We have our own perceptions of the NHS, shaped by the images we see on our screens. In the case of OBEM, these images are embellished with stories of women’s struggles within a pristine and perfectly-oiled system. If our own experiences differ from the narrative, we assume it’s an anomaly, an exception – that we were simply “unlucky”.

The reality is that the NHS chief executive Sir David Nicholson says £20bn must be shaved from the budget by March 2015, much of which involves hospital closures or downgrading. This is something which many campaigners see as cost-cutting not, as is claimed, an attempt to provide a more efficient service. While we happily watch an army of midwives fawning over newborns in immaculate hospitals, the government is undertaking the biggest NHS restructuring in history, which massively impacts the levels of care women can expect to receive.

The Maternity Services Survey 2013, which examines the experiences of women in 137 NHS Trusts in England, found that “more women felt that they were treated with kindness and understanding and had confidence and trust in the staff caring for them during labour and birth” than during the last survey in 2010. But it also revealed some worrying findings.

Among them was the fact that almost one in five women feel their concerns during labour were not taken seriously. Of the 230 women who provided comments about their experiences of accessing care, only one comment was positive. Of the remaining comments, over 87 per cent referred to women’s negative view of their care.

The UK may well be one of the safest places in the world to give birth, but all is not well. It has one of the worst rates of stillbirth in the developed world, and according to a globally-renowned professor of maternal care, government restructuring is to blame. What’s more, despite the majority of maternal deaths happening post-birth, budget pressures mean that almost half of new mothers are not immediately made aware of how to spot life-threatening conditions. And although the government has pledged that women can expect consistent care from a single midwife during labour, 46 per cent say they do not receive this.

OBEM has shone much-needed light on the experiences of women in labour, but the programme’s rosy depiction of our maternity wards shields us from the gruesome reality of what’s actually happening to them. If we were privy to the strains being placed on our wards, we might just be spurred into action. While the NHS is in need of profound change to render it more sustainable, care for women and babies at the very start of life should be shielded from cuts. Let’s not confuse the care we wish we had with the care we actually have and in so doing, end up lulled into a false sense of security. In the age of progress, we often assume things can only get better. The truth is, programmes like OBEM depict how it should be. Sadly, for many of us, that won’t be the reality.

]]>
<![CDATA[Home and away: The Prince’s Boy by Paul Bailey and Other People’s Countries by Patrick McGuinness]]> The Prince’s Boy
Paul Bailey
Bloomsbury, 160pp, £16.99

Other People’s Countries: a Journey into Memory
Patrick McGuinness
Jonathan Cape, 208pp, £14.99

In his recent memoir about Paris, Inside a Pearl, Edmund White recalls that a meeting he organised between the francophile English novelist Julian Barnes and the anglophile French novelist Marc Cholodenko turned out to be “stiff” because neither had any interest in the other’s country except as a source of “counter-examples” with which to mock compatriots. Cholodenko hasn’t been published in Britain but readers of Barnes’s work will be familiar with his manner of invoking the French – “The English don’t have cousins the way they do”, etc – and a variation of the strategy can be recognised in Evelyn Waugh’s use of Africans and Martin Amis’s use of Americans. It’s a kind of chauvinism that feigns engagement.

When the novelist Paul Bailey first visited Romania, at the end of the Ceausescu years, he went as a former south London grammar school boy and a novelist in a consciously English tradition. It has taken him a while to engage with the country on its own terms. In Kitty and Virgil (1998), the Romanian character was seen from the perspective of an Englishwoman. In Uncle Rudolf (2002), Romanian experience was recalled by a naturalised Englishman.

Bailey’s new novel, The Prince’s Boy, presents a rich man’s son named Dinu, who travels from Gara de Nord in Bucharest to the Gare du Nord in Paris in 1927 with a view to becoming a poet or novelist. Instead, partly thanks to his reading of Proust, he becomes an academic. More significantly, he meets a fellow Romanian, Razvan, a well-known prostitute and an alleged acquaintance of Proust, with whom he falls in love. The mood of Dinu’s reminiscences, composed in the late 1960s, is one of rapture shot through with loss, the latter emotion becoming stronger when the story reaches the 1930s and Dinu’s homeland starts to display its “talent for farcical brutality”.

To discover in the final pages that Dinu, “Romanian by birth, French by choice”, ended up as an accidental Englishman is a source less of disappointment than relief. It explains, if belatedly, the fussiness of the book’s prose: “green in the ways of the flesh”, “inspirational aspirations”, “What in God’s holy name was happening to me?”, “our mutual hunger once assuaged”. And it confirms Bailey’s reluctance to coddle the reader with an Anglocentric viewpoint.

When Julian Barnes wrote a story about a Romanian in exile, “One of a Kind”, he chose as his narrator an English novelist full of Barnesian glibness (“I always had this theory about Romania. Well, not a proper theory: more an observation, I suppose”). That Dinu eventually settles in England does little to diminish the thoroughness with which Bailey executes his central task – to evoke what it would be like not for an Englishman to be a Romanian, or for someone with the author’s English cast of mind to have been born in Romania, but for a Romanian to be a Romanian. If there is a limit to what Bailey achieves here, it has less to do with sympathy of imagination than exuberance of invention. Devoted Bailey readers, on finishing this slight successor to the slight Chapman’s Odyssey (2011), may find themselves yearning for his old untamed energy, the force behind earlier exercises in male befuddlement such as Gabriel’s Lament (1986).

Patrick McGuinness, an academic and poet and the author of a novel about the end of the Ceausescu regime, The Last Hundred Days, has also attempted a sort of Proust-in-miniature in Other People’s Countries. It’s a memoir in vignettes – part essay, part poetry, part prose poetry – concerned with Bouillon, a Belgian municipality near the French border where his mother’s family lived and where he partly grew up. McGuinness emerges as an insider with distance, able to note Bouillon’s “eccentricity and exoticism” while still considering it his home. Recalling how he used to think “Evenbrussels” was a place, because his awestruck relatives would refer to “Mêmebruxelles” (as in, “Lucie’s dresses are worn in Arlon, Namur and even Brussels”), he appears affectionate rather than condescending.

If the charm of McGuinness’s reminiscences helps to ward off self-indulgence, his weakness for theory – his desire to write meta-memoir as well as memoir – undoes much of the good work. Although Other People’s Countries is billed as an extension of the bedtime stories that McGuinness tells his son and daughter, it contains a great deal of intellectual rummaging that you wouldn’t wish on your worst enemy’s children: “my idea of what the house remembers about itself”, “It seems important to distrust the material, maybe even to make distrust itself the material”, “those three stooges, the past, the present and the future”, “This house of mine, this house of mind”, and so on.

The stooge-like past being so hard to get straight, McGuinness is annoyed that the English language insists on not being good enough, forcing him to wrist-slap widely accepted metaphors. Of “takes place”, he writes, “Place can’t be taken”; “When we say ‘naturalised’,” he points out, “we actually mean ‘denaturalised’.” But McGuinness’s figurative language doesn’t always do what he wants it to, as when he writes that a speeded-up recording of his voice made him sound “like a breathlessly excited Charles Hawtree”, an image that combines a redundant simile, a tautology and a misspelling.

Towards the end, he plays his hand a little too aggressively. After recalling an “old lady” with a “lucky rabbit’s foot dyed in the national tricolour”, he writes, “I couldn’t have put it better myself” – presumptuously alluding to his own powers of eloquence and doing so with a cliché.

Leo Robson is the NS’s lead fiction reviewer

]]>
<![CDATA[Life itself is encrypted – but can you find the Easter eggs?]]> “To live, to err, to fall, to triumph, to recreate life out of life” – what a fitting sentiment to accompany the birth of a new organism. It’s a quotation from James Joyce’s Portrait of the Artist as a Young Man, and came as part and parcel with the creation of the first synthetic cell in 2010. Synthia – as it became known – was constructed by the scientist Craig Venter, who assembled its genetic code in a computer, and wheedled it into the chassis of an eviscerated cell, whereupon it became alive. The quotation, along with two others also encrypted in DNA, was buried in its genome.

Life itself is encrypted. DNA is the code – a set of instructions on how to build an organism. The work of cracking the genetic code in the 1960s was to understand the encryption of life. It did just that, as we now understand not just how genes work in living things, but how the rusting codes in our genomes betray our evolutionary history. Genes that were once vital are no longer, but leave coded shadows in our DNA.

Venter’s project was steganography – the art of hiding messages within another work. His motivation, I suspect, was partly hubris, but ostensibly to watermark the genome as manmade. But it comes from a long, fun, and seriously nerdy tradition that covers pretty much every cultural form. These messages are now more commonly known as Easter eggs, primarily from the hunts devised by programmers hiding treats in software. Many of us remember the excitement of discovering “the Hall of Tortured Souls” – a 3D adventure encoded by a disgruntled employee in Microsoft’s fairly rubbish Excel 95 spreadsheet, only accessible via a code in a particular cell. Video games are crammed with Easter eggs, and the race to find them is now standard practice. It suits the medium so well because the code itself is largely invisible and impenetrable to the user.

Easter eggs in music are legendary, frequently recorded backwards, or “backmasked”. The Beatles did it, Pink Floyd too. Play Jay Z’s track “Lucifer” backwards, and it may well say “666, murder murder Jesus”. Some satanic, some godly, these messages are mostly plain silly, but none more so than Ozzy Osborne’s on his track “Bloodbath in Paradise”, openly – secretly – mocking the devilish decrees of his metal brethren: “Your mother sells whelks in Hull.”

In books, recall, if you can, Kit Williams and his beautiful Masquerade. Published in 1979, every page contained a clue to the location of an 18-carat golden hare, which was buried under the shadow cast by a crucifix at midday on the autumn equinox. Novelist Ernie Cline launched a modern quest in his wickedly fun 2009 book Ready Player One – a tale of a global hunt to find three Easter eggs hidden in a huge future online world, the prize being ownership of the mega-billion dollar company. It’s irresistible to us of a certain age and geekiness, as the book is littered with references to 1980s video games and films such as Ghostbusters and Back to the Future. But what no one knew was that there was a real hunt in the book itself. It was claimed in 2011 – the prize: a Delorean.

In cinema, the practice is rife too. Each movie from the animation studio Pixar hides a character from their next film. The Toy Story films are weirdly laden with references to Stanley Kubrick’s horror The Shining, from the creepy iconic 1970s carpet, to the apposite name of a security camera in the Toy Story 3 – Overlook 237 – a reference to the Hotel, and its spookiest room. Even film posters are not immune to steganography. The one-sheet for Silence of the Lambs features the image of a skull on the back of a death’s head moth covering Jodie Foster’s mouth. Look carefully and you’ll see it’s actually composed of naked women – as indeed are the irises of the classic jazz-age cover of The Great Gatsby.

Books, DNA, films and Easter eggs: these are some of my favourite things. Which brings us to my book Creation. It was published in 2013, about the parallel sciences of origin of life research, and genetic engineering. I, like plenty of film nerds, have good recall for lines from movies. Simply for my own amusement, I always hide them in scripts, articles and books. Mostly these go unnoticed. Mostly. Creation has plenty, 20 at last count, some explicit, some merely a reference or paraphrase. In doing so, I had inadvertently hidden Easter eggs in a book in which I describe DNA Easter eggs. And thus the game was afoot. Creation is a book in two halves, and its gimmick is that both halves have their own cover, and are inverted, so you can read each from either direction. Many people asked me what happens in the middle of the paperback, to which the answer was, it contains the following text:

TTCTAGCTGCTGTAGTGGTAGAGGTACTGCACCTAGCTGGCC
GGCGTGAGCTGCGTGAACATCTGCGTGCTGGTGAGCTGCGCC
AACGACATCGACGTGAGC

Using a standard DNA cipher described in the book revealed that that code spelt out this:

CREATI.NATVKD.TPENGVINGR.VPD.TC.M

The encryption I used doesn’t have O or U in it, but, my presumption was that anyone sharp enough to translate it would spot the full stop ‘CREATI.N’ stood in for an O, and the V in PENGVIN stood in for a U, and thus realise that it is an email address. We put it out on Twitter, and the first email arrived an hour later. The people who wrote to it were directed to a website, which contained a video. That film was a mock of the denouement of the Usual Suspects, in which (spoiler alert) the plot is revealed to be almost entirely unreliable by clues on a notice board. In my appallingly acted version, the instructions were given to hunt down my own watermarks, homages, and games: three quotations buried in the text.

A week later, four winners had all claimed their prizes, a stack of books from Penguin. They all found a line from “Life on Mars” by David Bowie. Two identified a made-up word from The Simpsons, and one a made-up creature from The Princess Bride. But in total the winners only found eight. The official hunt is over, but can you do better? Start at the very beginning. It’s a very good place to start.

Adam Rutherford is the author of Creation which has been shortlisted for the Wellcome Book Prize 2014

]]>
<![CDATA[Standing packed together on trains but studiously ignoring each other is nothing new]]> In Edgar Allan Poe’s story “The Man of the Crowd”, the unnamed narrator chances upon a strange old man in a London tavern. Following him through the streets after closing time and then throughout the night, the narrator realises, with mounting horror, that his quarry is compelled to seek out his fellow men – the waifs and strays of the urban night – simply so he may continue to be part of the generality rather than a singular individual. The poor fellow cannot otherwise exist: he is the man of the crowd.

Written in the late 1830s and set in London – at that time the largest city in the world – Poe’s story is a seminal work registering the creation of modern urban life and our psychological response to it. Translated into French by Baudelaire, it became a foundational document for his conception of the flâneur; but what I find most suggestive about the story is the narrator’s description of the old man’s face – which he says is shockingly grotesque, to a degree unprecedented in his experience.

In common with most city-dwellers I inhabit the urban mill-race much as a fish does a shoal: regarding my fellow men and women of the crowd but little, so long as they are swimming in the same direction. A complex repertoire of psychosocial behaviours has been built up over the past two centuries in order for it to be possible for us to exist bum-cheek-by-wincing-jowl with myriads with whom we have no connection: we don’t speak to them; we appear purposive and goal-driven; the advent of modern technologies – particularly personal sound systems – has been incorporated, so that now we can stride through the streets, or stand packed together on public transport, each occupying our own parallel world of reclusion.

Actually, this is nothing all that new: the emergent technology of the mass-produced newspaper and the book were factored in to the crowd dynamics of the late 19th century. Ambulatory City commuters of this time – the clerks and computers, Eliot’s undead who streamed across London Bridge – spontaneously formed into contraflow lanes so they might read as they walked, thereby snatching a few reclusive moments apart from the mass tyranny of the clock. But perhaps the most essential attribute required to be an urban survivor is a strange visual impairment: a concerted ability not to look anyone in the face.

It’s said of those on the autistic spectrum that because they have no intuition of other minds – what George Eliot typified as understanding that other people possess “an equivalent [and separate] centre of self” – they display little interest in facial expressions. By that analysis, everyone sitting in the train carriage with you right now is functionally autistic.

We do look at other visages in the crowd – but these are only brief, probing glances, the aim of which is to establish the likelihood of threat or the remoter possibility of sexual attraction leading to lifetime love and security. What we don’t do – what, in fact, we daren’t do – is examine strangers’ faces for prolonged periods, bringing to bear on them all our imaginative and empathetic capabilities.

Over the past week or so, having previously enjoyed a period of intense solitude while working on a book, I’ve been savouring my regained freedom and exposure to humankind by doing just this: instead of walling myself up behind book or screen, I have been surreptitiously scrutinising faces wherever I go. Several things have struck me while undertaking this field research on our species. The first is quite how difficult it is to describe faces. Of course, as a writer, I knew this already – although it’s an axiom of fictional characterisation that in respect of physical appearance less is usually more: the reader needs to have something for his or her own imagination to do, and so cherishes being given a free hand on these immaterial countenances.

We might say that a mouth is generous, or eyes deep-set, or cheeks acne-scarred, but when set beside the living, breathing, infinitely subtle interplay of inner thought, outward reaction and the nexus of superimposed cultural conventions, it tells us next to nothing about what a person really looks like. We often experience this disjunction between appearance and reality most acutely in representational art; in painting, for instance, we readily grasp the distinction between artists who can portray the fleshly form of the psyche, and those who merely produce likenesses. Not for nothing did Baudelaire entitle his essay about the flâneur “The Painter of Modern Life”.

The flâneur stands apart from the crowd and is unafraid to see the individual rather than the functional stereotype imposed by mass urbanism – but it is a deeply uncomfortable perspective to adopt. Once you begin to analyse a stranger’s face she ceases to be a stranger: you feel the living oppression of her illnesses and neuroses, her joys and her sadness – she becomes part of a tightly knit community that takes up residence in your mind alone. And this explains why it is that Poe’s man of the crowd is so very physically repugnant; because he can only exist in a condition of anonymity, he has absorbed all of the alienation and lack of feeling such a state necessarily implies. To employ a favoured idiom in my part of the world: he looks like the back of a bus.

]]>
<![CDATA[Flowers from beyond the grave: The Insufferable Gaucho by Roberto Bolaño]]> The Insufferable Gaucho 
Roberto Bolaño, translated by Chris Andrews
Picador, 176pp, £14.99

Last year, I asked Carolina López, Roberto Bolaño’s widow, what it had been like to watch her late husband’s work spread far beyond Spain towards global renown. At first I thought she replied that the “explosion” of his work had been a bad time for her. (“Because Roberto wasn’t there,” she added.) In fact, she hadn’t said anything about an explosión but had used the similar-sounding word eclosión, which means something more like flowering or blooming.

López’s term is apposite. Bolaño’s books are still appearing and we have not finished understanding them. In the UK, we lag behind the Spanish versions by between five and ten years, so we are still catching up with works that were published in the author’s lifetime or just after. This new collection, which includes five stories and two essays, is said to have been the last book he prepared before his death in 2003.

The title story features rabbits that may have murderous designs. Manuel Pereda, a lawyer from Buenos Aires, has a political awakening and returns to a ruined family ranch on the pampas. He stops washing and takes to riding his horse into bars, where he slurps eau de vie and spits on the floor. Pereda’s son, a debonair novelist from the city, visits at one point with his publisher. Pereda and the publisher are out riding one day when a rabbit leaps up out of nowhere and bites the publisher’s neck. “From where he was, all Pereda saw was a dark shape springing from the ground, tracing an arc toward the publisher’s head, and then disappearing.”

Bolaño traced a similar trajectory. The Spanish writer Enrique Vila-Matas has said that Bolaño’s great early novel The Savage Detectives did not emerge from nothing, as some have thought, but from the “implacable machine of anonymity”. The years of thankless scribbling in the critical dark, Vila-Matas argues, gave Bolaño an unstoppable energy and creativity. (He was about to revise the drafts of 2666, widely regarded as his masterwork, when he died.)

He appeared, delivered his mordant message and vanished again only too soon. It was mordant but not unmitigated: in Bolaño’s work, humour often functions to undermine the sense of threat. The literary world is a frequent butt of this bathos. When one of the son’s friends, another ambitious literary type anxious about his connections, sees blood on the editor’s neck, he exclaims, “Son of a bitch! . . . Your dad’s gone and killed our publisher.”

Writers often teeter on this knife edge between violence and absurdity in Bolaño’s work. They either come across as charlatans or as anarchic, Rimbaldian prophets not yet properly understood. It is up to the reader to pass judgement. In the first story, “Jim”, the narrator sees a friend of his watching a fire-eater in the street. Jim is so transfixed by the spectacle that he is still watching the performer when all the other bystanders have moved on. It is as though he alone has understood; the fire-eater (or the writer) is performing exclusively for him.

Other stories explore the writer’s anxiety over whether he will ever be understood. In “Álvaro Rousselot’s Journey”, the novelist Rousselot, at first irate that a film-maker called Morini seems to be plagiarising his plots, is then crushed to see further Morini films that bear no resemblance to his succeeding novels. Rousselot is “preoccupied by the thought that he had lost his best reader, the reader for whom he had really been writing, the only one who was capable of responding to his work”.

The pair of stories in “Two Catholic Tales” are from a different mould. Devoid of the humour that flashes through the other pieces, they evoke the sinister, hallucinatory atmosphere of the sections of The Savage Detectives narrated by Joaquín Font as he languishes in a psychiatric hospital. “The Myths of Cthulhu”, the final essay in the collection, finds Bolaño on more typical form, showing off his caustic wit, complaining that writers are not the hedonistic tearaways they used to be: “Vargas Llosa never gave a better lesson in literature than when he went jogging at the crack of dawn.”

This is the armour of the posturing Bolaño: the competitive shell that keeps us out of his non-fiction. In the fiction there is more nuance. Bolaño knew that, like all writers, his eventual fate would be oblivion. Whether his work bloomed like a flower or exploded like a bomb, the dust would some day settle on it. Rousselot is described at one point as “one of the five rising stars among the nation’s younger writers”. Two senten­ces later, even that (gently ironic) honour is tainted: “It is common knowledge that the rising stars of any literary world are like flowers that bloom and fade in a day; and whether the day is literal and brief or stretches out over ten or twenty years, it must eventually come to an end.”

]]>
<![CDATA[I’m living with a house-proud northern woman who has just uncovered the kitchen]]> And so there is a new occupant in the Hovel. It can’t be helped. The general consensus among my friends is that the poor woman must be either on the run from Interpol or a homicidal lunatic who has inveigled her way in here under false pretences but, as far as I can see, she is neither: she is simply a house-proud northern woman about my age.

You begin to see the problem right there, don’t you? “House-proud”. I am many things – well, one or two – but “house-proud” is not among them. I am house-shamed.

As I may have mentioned before, I was blessed at birth with the ability to make a room messy just by looking at it. If I want to render it uninhabitable, I have to sit down in it for about five minutes. This is much more than a class thing: it is supernatural. Then again, you will not find me scrubbing the doorstep every Saturday morning, whether it needs it or not.

Anyway, I came down on her first morning to find an entire room where the kitchen had once been. Everything had been tidied away. Where, I know not.

The kitchen, which last saw development around the time Clive Dunn’s “Grandad” was No 1*, has six drawers, three of which are unusable because the bottom has fallen out of them and three of which are unusable because they are full. The cupboard space beneath them is an area bitterly contested between the saucepans, assorted unnameable bric-a-brac and Mousie, apart from the cupboard under the sink, where even Mousie will not go.

Either this woman has access to Time Lord technology or some things have gone, perhaps for ever. William of Ockham told us not to multiply variables unnecessarily, so I will for the time being assume Time Lord tech. Not only theoretically but practically, I know that tidying up is possible. After months of looking around me with a sick feeling and putting it off for ages, I spent the hours of midnight to 2am tidying up the living room the night before her arrival – but who does it voluntarily?

Exhausted, I’d left the kitchen alone, apart from cleaning the breadboard and doing the washing-up, bar a few items of cutlery that were beneath contempt. I couldn’t see where anything else could go.

Anyway, things got off to an inauspicious start the next day. I have, since living practically alone, let myself go a bit. It’s a gradual process, like one’s children growing up; you don’t notice it so much on a day-to-day basis but if you haven’t seen someone else’s kids for a year or so it can be quite a shock.

Likewise, I think I might present an alarming spectacle to someone who last saw me (and only briefly) about two months ago, when I had made an effort to scrub myself up. I now have a straggly white beard, like a strange fungal growth, or a cobweb in a cellar. My toenails have sheared through the front of my slippers and scratch, claw-like, on the ground when I walk.

My eyes are red-rimmed and sunken from a strange combination of too much sleep and too little sleep. My expression is that of a man hunted by the Furies and hag-ridden by nameless fears. I look, in short, like late-period Howard Hughes, without the money.

“You cleaned the inside of the teapot,” I snarl.

Dimly, the last human part of me – think of the remnants of Sméagol still minutely present in Gollum – recognises that, as welcomes to the Hovel go, this is somewhat lacking in politesse. But one becomes attached to one’s mess, especially if it is all one has. Still, the inside of the teapot is another matter. If, like me, you are miserably fussy about your tea (because that, too, is all one has), then you will know that you never clean the inside of a teapot, because doing so ruins the taste. And, as it turns out, the poor woman does not herself drink tea. “My husband never cleans the inside of the teapot,” she says. “I always thought he was just being lazy.”

I conceive an immediate bond of sympathy with this man, wherever he is. I deliver a brief but impassioned lecture about the unwisdom of cleaning teapots, or, indeed, anything else that is My Precious, and claw my way back to bed. Jesus, the poor woman.

*January 1971. Clive Dunn was almost exactly the age that I am now when he recorded it

]]>
<![CDATA[Comic Sans gets neue lease of life – but it may end in tragedy]]> Love it or hate it, the Comic Sans typeface makes amateur typographers of us all. Now a new version has appeared, promising to lend credibility to the comic line of typefaces.

Comic Neue, designed by Craig Rozynski, is like Comic Sans but has been designed with some key differences that are supposed to make it less unsightly.

We don’t normally talk about typography and often only notice typefaces when they are atypical or inhibit our ability to read. Comic Sans is different. It divides opinion among those who don’t usually identify as typeface enthusiasts. And in its wake, Comic Neue is causing a stir too.

Rozynski says on his website that the typeface “aspires to be the casual script choice for everyone including the typographically savvy”. Do we really need another comic script though? Was Comic Sans really that bad in the first place?

The unloved typeface

If you have been near a computer in the past 20 years, you have likely encountered Comic Sans, the “fun” typeface with rounded edges that appears to be written with a felt-tipped pen.

Comic Sans: bringing comedy to tragedy.
Luwig van Standard Lamp, CC BY-SA

If you are an amateur designer, it’s the go-to typeface for just about any occasion that requires a relaxed approach. If you are an experienced designer, it’s the last typeface you’d ever use, unless you want to be ridiculed without mercy.

The typeface, now approaching its 20th anniversary, was originally designed by Vincent Connare for Microsoft Bob, Microsoft’s 1995 interface for various iterations of Windows.

Microsoft Bob came with a dog that would interact with the user. In the initial version of Bob, the dog offered assistance in speech bubbles using Times New Roman. Connare decided that comic dogs probably wouldn’t “speak” that way, and went to work designing something more interesting. He used the hand-drawn characters found in popular comic books like The Dark Knight Returns and the Watchmen series as inspiration for what would later become Comic Sans.

Since then, the typeface has been used for everything from physics presentations to papal documents and its popularity is only matched by the disdain some people have for it. People feel so strongly about the typeface that there is even a website devoted to banning Comic Sans entirely. It is this ridicule that prompted Craig Rozynski to redesign the typeface into the new Comic Neue.

Friendly font

Comic Neue is a sans serif typeface designed to appear casual and friendly. There are numerous different characteristics of the typeface that convey this tone. Generally speaking, the more a typeface resembles handwritten text, the more it is perceived as casual.

Each letter, or character, in a typeface is comprised of a series of straight and curved lines called strokes. While some typefaces change the width of a stroke drastically, each stroke of Comic Neue is the same width throughout. This creates what designers call a mono-weight typeface. These mono-weight strokes mirror the strokes you would get with a pen or pencil. The end of each Comic Neue stroke also comes to a rounded point, which again mirrors handwriting.

Certain characters, such as the lowercase a and g also tell us a great deal about the tone of a typeface. These specific letters have two different variations, known as single and double story.

Single story letters have one enclosed or mostly enclosed space, called a counter. Double story letters have two counters. Single story letters, like those found in Comic Neue, are considered more casual and friendly.

Stay away, kids. Sermoa, CC

All of these casual attributes can be found in both Comic Sans and Comic Neue. What separates Comic Neue from Comic Sans, however, is the perfection found within each character. Where Comic Sans strokes are often crooked, Comic Neue strokes are exact. The vertical strokes are perfectly vertical and the counters are uniformly rounded. These small changes, combined with a thinner stroke throughout, convey a slightly more professional tone.

Your neue best friend?

Comic Sans is arguably the most misused typeface in history. It incites laughter in some people and rage in others. While the changes made to it to create Comic Neue do contribute to a more professional tone, there is no way to tell if the typeface will be more socially accepted.

The reputation of the comic typefaces may well be irreversibly tainted forever. Some might argue that is a good thing. The internet enables access to a seemingly endless selection of “comic” typefaces: Janda Manatee; Smart Kid; Action Man; Cartwheel; Rudiment; or even the rather unwieldly-named Year Supply of Fairy Cakes. But few of these have ever made it into the mainstream.

Yet other much maligned typefaces are regularly used. Papyrus, a font which many hate as much as Comic Sans, remains a mainstay for many designers.

So can legitimacy be granted to a family of fonts that, by their very nature, are designed for fun? The remains to be seen. In the meantime, Comic Neue offers us one more opportunity to decide if we really need a comic font for that all-important business document.*

*We probably don’t.

The ConversationThe authors do not work for, consult to, own shares in or receive funding from any company or organisation that would benefit from this article. They also have no relevant affiliations.

This article was originally published on The Conversation. Read the original article.

]]>
<![CDATA[Sympathy for a wife-murderer: a feminist killjoy review of Fargo]]> Fargo, the FX television series adapted from the Coen Brothers’ film of the same name debuted in the UK last night on Channel 4. In the run-up to it being aired, I was excited. I’m in between boxsets just now, having finished Breaking Bad a couple of months ago and not yet settled on a successor, and Fargo appeared to have all the ingredients for a series I could really get my teeth into. To avoid spoilers, I tried to avoid reading too much about the plot in advance. Perhaps if I had, I would have averted some disappointment. Because one hour in, it became clear that it’s probably not going to work out between Fargo and me. My feminist killjoy button has been activated, and now there’s no turning it off.

In the first episode, we meet insurance salesman and henpecked husband Lester Nygaard, played by Martin Freeman. Lester, we are to understand, is one of life’s losers, one of those essentially nice guys that the world just isn’t kind to. We learn that he was aggressively and humiliatingly bullied at school; that his younger, richer, better-looking brother is embarrassed and piteous of him; that his wife, Pearl, is a nagging harridan who openly impugns his masculinity, and laments the fact that she married the wrong brother. Lester works hard at his job, despite the fact that he is a hopeless salesman, and attempts to satisfy his harpy of a wife, but in so doing – trying but failing to mend the turbulent washing machine – only further demonstrates his lack of manhood in her eyes. Lester is presented as the perfect underdog protagonist, the kind of guy we can’t help rooting for. Seeing him being taunted afresh by the high school bully seventeen years on, and being mocked and harangued by his heartless crone of a wife, the viewer is almost willing him to flip and go on a murderous rampage.

And of course, that’s what happens, or something along those lines. Inspired by the brutal act of retribution a new acquaintance inflicts on the high school bully, Lester makes one final attempt to reclaim his lost manhood. Once more taunted by Pearl’s hectoring, and pushed over the edge by her derisory, scornful taunts – “oh, are you going to hit me?!” – Lester inevitably snaps, and hits her over the head with the hammer he had been wielding. For a second or two we, watching through Lester’s eyes, wait in stunned silence for the consequences of this act of madness to become apparent. As the blood begins to trickle down Pearl’s forehead, it becomes clear to us, and to Lester, that this is serious – there’s no going back from this. He might as well make sure the job is done properly now. And so we watch, as he continues to bludgeon her with the hammer, until she is well and truly dead.

What are we to make of this, the audience who up until this point have been rooting for the underdog, the nice guy who always finishes last? I can only assume, given how sympathetically Lester has been presented – and given that he is the story’s main protagonist – that we are to feel understanding and compassion for the predicament he now finds himself in, and share his panic about how he’s going to get out of it. And indeed, the part of my consciousness that is not being drowned out by the feminist killjoy klaxon felt exactly that for him. Of course Lester beat his wife to death with a hammer. Who wouldn’t, with a wife like that? The poor guy, constantly belittled and emasculated in every aspect of his life. Of course he snapped. Of course he lost his temper. She was mocking him. She was taunting him. She was daring him to do it. I would have hit her with that hammer too.

But this is the point at which I can’t just go with the flow, and shut off the feminist klaxon. I can’t just let myself be carried along in this natural wave of sympathy for Lester, even though this means my enjoyment of Fargo is now effectively ruined. I feel this way about Lester because I have been directed to feel this way by the narrative presented, and the not-at-all-nuanced portrayal of his character. If this were an accurate depiction of a true story, as the opening message at the start of the show would have us believe, I might really think that, heinous as his crime is, poor Lester Nygaard is still deserving of some compassion and understanding, that the blameworthiness of his actions is mitigated by the myriad ways in which the world has wilfully broken and humiliated him. If such a pitiful and tragic character could ever exist outside of the world of fiction, then he would indeed be deserving of some sympathy. But in reality, no person could be so tragic, so comprehensively victimised and universally dehumanised, and no wife could be so thoroughly, completely cruel, so callously and relentlessly disparaging. To present spousal murder in this way is to reinforce a dangerous myth about the men who murder their wives – that they are henpecked husbands, ground down by their wives’ nagging and emasculated by their hectoring, who then inevitably, understandably, snap. Or that they are loving, caring husbands and fathers, right up until the moment that the humiliations and indignities imposed upon them by an unjust world leads them to execute their entire families before killing themselves.

It is understandable why we would want to believe that the men who murder their wives are Lester Nygaard figures, and that the women they murder are cold-hearted, nagging shrews getting divine retribution for a lifetime of emasculation. Apart from enabling us to enjoy Fargo without discomfort, it also allows us to avoid confronting the real truth about domestic violence – that it is not the inevitable but tragic snapping of a mind pushed to the edge, but endemic to our societal notions of masculinity. We all know by now that in the UK, two women a week are murdered by their partners or ex-partners. Comforting as the illusion may be, these murders cannot be neatly filed away as individual catastrophes, the sad but inevitable consequence of shrill, domineering women pushing kind, loving, hard-working men to breaking point. Most wife-murderers are not decent, gentle Lester Nygaards, no matter how much they believe that they are, or want us to believe that they are. They usually have long histories of violence, towards their wives and others. Most wife-murders don’t just happen out of the blue, when a kind but fragile man snaps. They are usually the culmination of a long pattern of controlling and abusive behaviour, and could possibly have been prevented, if only we cared enough to take them seriously.

I will probably keep watching Fargo. If I wanted to avoid everything that contained damaging depictions of women, I would have to live in a cave. But I definitely won’t be rooting for Lester Nygaard. 

 

]]>
<![CDATA[Vince Cable: “What makes me human is a love of dance”]]>

Embraceable you: doing what comes naturally
at a local social in Haute-Savoie.
Photo: Jean Gaumy/Magnum Photos

What makes me human is a love of dance. On the dance floor, age, colour, nationality, status and education are of no consequence, only a shared ability to respond to the rhythms of music.

I suspect that far more people know me as the bloke who appeared on Strictly Come Dancing than have ever heard my speeches or read my books. A ten from Len mattered more to the public than a glowing editorial will ever do – and probably to me also.

My dancing experience started badly as a gauche, one-footed teenager who hovered in the corner with the other boys whenever the school or church organised some ghastly “social”. But I was soon caught up in the sounds and beat of the rock’n’roll era. Dancing just happened naturally, untaught.

One episode opened my eyes to the power of dance. As a student, I was travelling with friends across Khrushchev’s USSR. We stopped in Kyiv and wandered into a park enclosure where Soviet youths were dancing, rather sedately. I spotted an attractive girl, took her on to the floor and launched into a fast and rather unruly jive. Before long, the local people joined in. Then a couple of heavies appeared and frogmarched the two of us away. I was given a stern lecture in broken English on “western degeneracy” and she narrowly escaped charges of hooliganism.

Some years later I lived and worked in East Africa. There I fell in love with Olympia, my late wife. Olympia was a Goan who had been brought up with a love of music and dance. She was a talented classical pianist, but was no music snob, and switched effortlessly from Beethoven sonatas to Elvis Presley love songs. We courted in the nightclubs of Nairobi and danced to fashionable bands from Congo and South Africa. The warm glow of remembrance of those days is always suffused with those sounds.

Children and careers put paid to our dancing. But when our children had passed the babysitting stage, we wanted to do things together and discovered Kelly’s, the local dancing school. We had always danced by instinct, so we had to start from scratch with the basic techniques of ballroom and Latin and with memorised routines. It was difficult and we almost gave up, but we both had a streak of determination and competitiveness and started to climb the long ladder of grade examinations.

This burgeoning hobby came to a sad end when Olympia fell victim to cancer, which, in its later stages, disabled her. I put dancing in the past tense, and the medals were tucked away.

After Olympia died, I wanted an escape from grief and went back to the school where our teacher, Sam, offered to partner me. I gradually improved and passed more exams. That led to an enterprising television producer fixing up a dance with Alesha Dixon, the hot favourite to win Strictly that year (which she did), and, from there, to the Strictly Christmas show and a foxtrot with the wonderfully gifted Erin Boag to the sentimental strains of “Walking in a Winter Wonderland”.

Now, my Friday dance lesson is jealously protected: a small refuge from a fraught ministerial routine. For an hour, I completely switch off from affairs of state and immerse myself in the finer points of posture and footwork. In truth, in my eighth decade, the hips no longer move as freely as they once did. But there is satisfaction in small improvements and I can learn much from my teacher Nick and from my partner, Cheyenne, who together mix teaching with competing to join the world’s top couples. And in the background another coach, Anne Gleave, in her day the world’s number-one professional dancer, is coaxing perfection from some remarkable Chinese or American pair. It is a humbling but uplifting experience.

I have been happily remarried for ten years now. Rachel and I have no aspiration to join the world’s dancing elite or even to win medals. But it is one of our simple pleasures to roll back the carpet and dance – or, as we did last Saturday, turn up at a local dance and jive.

The “What Makes Us Human?” series is published in association with Radio 2’s Jeremy Vine show

]]>
<![CDATA[Hilary Mantel: “I do think the level of public debate is debased”]]>

Hilary Mantel, photographed by Leonie Hampton for the New Statesman in 2012 at her home in Budleigh Salterton, Devon

 

The scene is an early supper at the Arden Hotel, Stratford-upon-Avon. The time is just between the penultimate all-day Saturday performances of Wolf Hall and Bring Up the Bodies, the RSC’s adaptations of Hilary Mantel’s Man Booker-winning novels; the shows will close here in a week’s time before reopening at the Aldwych, in London, in May. The cast round the table is composed of Hilary, her husband Gerald McEwen, her younger brother Brian, Mike Poulton – who crafted these plays in close collaboration with Mantel – and me. We are discussing how familiar most of the audience are with the books. Mantel remarks on the opening of the first play, which finds Thomas Cromwell and Cardinal Wolsey in conference; at the edge of the stage is a young man playing a lute. A few moments in to the scene Wolsey sends him off with an abrupt, “Enough now, Mark.”

“A woman just near me leaned over and whispered to her companion, ‘That’s Mark Smeaton!’ – she was very excited,” Mantel says. It is Smeaton who will, in Bring Up the Bodies, play a crucial role in the fall of Anne Boleyn. And indeed, on the Saturday I was there, although I didn’t hear a whisper, a distinct frisson of recognition ran through the sold-out Swan. And that is the genius of both Mantel’s novels and now their stage adaptations: yes, you know where this story is going – but you are no less glad to be along for the ride.

That said, it’s not necessary to be closely acquainted with the books – or indeed with the history of Thomas Cromwell’s rise at the court of Henry VIII – to be enraptured by these plays, which opened to near-universal praise in January. The adaptations, wrote Susannah Clapp in the Observer, “go to the heart of Mantel’s fictions and give them a different life”. That is thanks not only to the elegant and energetic direction of Jeremy Herrin, but in a very large degree to the remarkable writing partnership that Mantel and Poulton have built. The three hours between the two plays allows plenty of time for dinner and a quiet conversation with Hilary in the hotel room that has come to seem much like home to her and to Gerald. They travel here at least once a week from Devon, driving up the M5 to Stratford and the Swan where, in the foyer, I watch Hilary greet a succession of adoring fans with both gravity and grace. She signs books and programmes and playscripts. I say to Gerald that she doesn’t look like she minds the attention at all. “Oh, no, she’s shameless,” he beams. Married for four decades – with a small hiatus in the middle in which they were divorced and then remarried to each other – they are now a working partnership too, with Gerald, formerly a geologist, driving the juggernaut that is Hilary Mantel, Inc.

And that is quite an enterprise these days. Born in Glossop, Derbyshire, she was for decades an enormously respected and successful author whose books were an established and admired fixture of the British literary landscape. Her first novel was her bracing account of the French Revolution, A Place of Greater Safety – though it would be published as her fifth book. When she tried to sell the manuscript, she was told that no one was interested in historical fiction – so, practical woman that she is, she sat down and produced Every Day Is Mother’s Day, her first published book, released in 1985. She has proved adept at moving between the present and the past in her fiction. The Giant, O’Brien is a fictionalised account of the damaged and damaging relationship between the 18th-century Irish “giant” Charles Byrne and the English surgeon John Hunter; Beyond Black builds a darkly funny bridge between the living and the dead in the size-22 form of Alison, a modern medium.

But her Tudor novels took her on to a different plane. Drawn to the enigmatic yet enormously powerful figure of Thomas Cromwell, the brewer’s boy from Putney who rose to be Henry VIII’s chief minister, she knew she’d have to publish Wolf Hall in 2009, the 500th anniversary of Henry’s accession; again, practical as ever, so she did. As to what drew her to Cromwell, not so long ago she and I discussed the so-called romance of her late-blooming success. She didn’t see her own story as romantic at all. “I think it’s the story of a hard-boiled careerist, like Thomas Cromwell,” she told me.

But now Wolf Hall and Bring Up the Bodies –  two densely woven novels that make no concessions to the reader – have become part of the national conversation: this year Mantel became the first Booker winner to make the top ten most borrowed since PLR records began (Bring Up the Bodies was the eighth most borrowed – poor old J K Rowling was bringing up the rear at tenth). Both books, on publication, received the kind of praise likely to go to any author’s head, though there were a few dissenting voices. (Susan Bassnett, professor of comparative literature at Warwick, called Wolf Hall “dreadfully badly written” in the Times Higher Education Supplement; Andrew Holgate, in the Sunday Times, said that Bring Up the Bodies was “curiously flat and leaden”.) She is the only living author with a portrait in the British Library.

That means that these days anything she says is liable to be pounced on by the press. This was most evident in February last year, when a sophisticated lecture she gave at the British Museum (and which was then published in the London Review of Books) was interpreted, mainly by those who hadn’t even bothered to read it, as slagging off the Duchess of Cambridge – or “Princess Kate”, as the Prime Minister, David Cameron, called her in an inept remark in her defence. A remark which made it perfectly clear that he hadn’t read the piece either. What does she think this whole fiasco said about the level of public debate in Britain?

She settles herself in her chair and folds her hands in her lap. “I think . . .” she smiles, coolly, “I think many things. I do think the level of public debate is debased. To know how far it is debased – well, you have to be on the receiving end of a hate campaign like that to know how bad it is. To be honest, it didn’t get to me or upset me as much as people might have assumed. It was very funny to have press camped out across the road in our quiet seaside town, and if the pressmen saw any fat woman of a certain age walking along the street, they ran after her shouting, ‘Are you Hilary?’ Pathetic! But it did furnish us all with a great deal of entertainment.

“Also, it taught me what I’ve long suspected: that public opinion is not something that features very highly in my life. Nobody should go into a trade like writing expecting applause, or universal approval, or even popularity. What appals me is that people mistake this constant storm of trivial abuse for some kind of freedom. ‘Me, speaking my mind!’ ” Her tone is boldly dismissive. “It’s not. It’s actually a huge distraction of the bread and circuses variety. To a large extent proper civic engagement, community engagement, proper political debate and activism, has been replaced by this. By illogic. By platitudes. And actually a lot of it is just abuse and bullying. There’s a nasty, narrow little conformism. And people are afraid, quite understandably, to differ from the norm. I think it’s a very sad state of affairs.”

There was a personal and unpleasant aspect to the response to her perceived criticism of the Duchess of Cambridge’s appearance – plenty of people felt free to criticise hers. “Mary Beard has pointed out that if you are a woman who ventures an opinion in public, ‘You are fat and ugly’ is thought to be an adequate response. This is what I got all the time after the Kate business. And, you know, I’m 61. Do people think my self-esteem is invested in my personal appearance? If it was, I’d be an idiot!” She laughs.

Mantel’s recent ascent to the stratosphere of writerly fame has not given her any illusions of grandeur. When Playful Productions, the company behind these theatrical adaptations, first got her together with Poulton, she saw herself as very much the “junior partner” in the process. “I didn’t know how it would be,” Mantel says of their first encounter. “And on Mike’s part there was a certain wariness, because he didn’t know how protective I would be. But we got a lot of that out of the way at the first meeting, and I don’t think he would have agreed to do it if he hadn’t believed me when I said that I was very flexible in my thinking, and that I didn’t really see it as an adaptation, but as a new work. So Mike’s first job was to demolish the structure, really.” She says this so easily, so lightly, that it’s only later I reflect on what creative confidence this remark reveals. Mantel knows what she is capable of; she trusts others to be as capable, too.

Poulton confirms that he was indeed wary on first meeting Mantel. Acclaimed as an adapter of literary works for the stage – his plays include a version of Schiller’s Don Carlos, starring Derek Jacobi, in 2004, as well as adaptations of Dickens and of Chaucer’s Canterbury Tales – he is used to working with authors who, by virtue of being long in the grave, can’t answer back. Asked by Playful’s Matthew Byam Shaw whether he thought Mantel’s books could be adapted for the stage, “I said, ‘Of course it can be done, if you get the right person – but please don’t ask me!’ ”

He was, however, persuaded to meet Hilary and Gerald – all the while thinking, “If she’s too protective, it will be impossible.” But she was not. “We got on straight away. It was only because of Hilary’s generosity in saying that while she had created these characters, they were waiting to leap off the page. We’ve fired each other up. Theatre is her great love: she just has that instinct, the eye for detail that a production needs.”

Ben Miles as Thomas Cromwell and Lydia Leonard as Anne Boleyn in Wolf Hall. Photo: Rex Features

Theatre is indeed Mantel’s great love. One could argue that she was writing for the theatre long before this collaboration began. A year and a half ago – at the end of 2012, when Mantel had been named Waterstones UK Author of the Year – she and I had an opportunity to discuss the method by which she constructed these vast, intricate historical novels. “What I try to do before I write a big scene is go over all the ground again,” she told me. “Get all my notes, and all the historical information, and have a last thrash through them to see where the contradictions are. At that stage, things jump out at you. If you can come to it with that sense almost of mental emergency – a feeling that everything is prepared – it will then go down on the page very quickly.” I said at the time that it sounded to me almost like rehearsing for a performance. “Exactly,” she said. “So each scene is preceded by stage fright. And usually a day of misery! And wondering if you’re up to it. So I suppose going through the historians, and my own notes, is like a technical rehearsal –  and then it should be 95 per cent there.”

Her love of theatre began right here, in Stratford, when she was just a girl. The summer after she had taken her O-levels she came, with two schoolfriends, to see four plays: As You Like It, Troilus and Cressida, King Lear and Faustus. She is still very close to one of the two girls. “The other I’d lost touch with – but I ran into her in the foyer at Wolf Hall in December!” she says. “We were very lucky; John Barton’s Troilus and Cressida was a groundbreaking production. But it was only then that I realised that there were people who did nothing but study Shakespeare, because there was the Shakespeare Institute here. But I had to sort of sheer away from it – it seemed too good. And I couldn’t . . .” she hesitates. “My stepfather” – Jack Mantel, whose name she took after her own father left the family when she was a girl, a story she recounts in her 2003 memoir, Giving Up the Ghost – “was a very angry philistine. And one of the things he was angry about was Shakespeare. And this was deeply unfortunate, because I managed to get hold of the complete works when I was ten, and absolutely adored it. Nobody had told me it was supposed to be difficult, so I didn’t find it difficult. I took it in through my pores. And so we made a very unfortunate combination. But imagine the faces if I’d said, ‘I want to go to university and read English and I intend to be a Shakespeare scholar’!” Instead she took a more practical route – no surprise there – studying law at the London School of Economics and Sheffield University. But the writing life she has built brought her back here at last. “With that turning not taken, it’s especially lovely for me to find myself working, virtually living, in Stratford and working with the RSC. It’s more than I hoped for. This has actually been the best part of my writing life, this last six months.”

Better than two Man Booker prizes? “They’re for what you know you can do,” she says. “The interesting thing is what you can do that you don’t know yet.” As the nine separate drafts of Mike Poulton’s scripts were crafted, she was deeply involved in the process, the two of them often emailing each other through the small hours. (One of the reasons they get on so well, I’m sure, is that when Mantel describes Poulton as “a perfectionist, and very hard-working, and whatever hours are required, he’ll put them in” she might as well be describing herself.)

Now she is working with Poulton on the changes that will be needed for the London transfer. They want to shave some minutes from the six-hour running time (“You don’t want people worrying about the last bus,” Poulton says) and, crucially, the configuration of the Aldwych is very different from that of the Swan. With the Swan’s thrust stage, the audience surrounds the players, who move on and off stage through the stalls; the Aldwych has a more conventional proscenium arch.

The adaptation isn’t a straightforward job. One of the chief things Mantel has learned, she says, is “the business of tailoring your storytelling to the fact that you’ve got a cast of 21 people, some of whom are playing two parts, some of whom are playing three. You can’t just have them walk on and off when you like. This makes you clever. Constraints are good for a writer. There are 159 characters in the books, and they all have their little parts to play; with a much reduced cast, trying to tell the same story, it’s a question of who can stand in for someone else.”

And so it was her deep understanding of character and history that was very useful to Poulton, she says. “I could say, ‘Well, actually, Thomas More cannot plausibly say this line, but Stephen Gardiner can.’ So you sort people out into blocks, according to their factions, friendships, known attitudes, all the cross-currents of friendship and enmity.” And this was possible because she realised very soon on that Poulton “would take the history as seriously as I do and not compromise. We won’t decide that Anne Boleyn can die six months before she really did – to take a crude example. We live with the shape of history.” And that in itself is a great constraint. As Poulton says: “The whole thing is like an arch, where every stone is a keystone: if you pull it out, you’ve got to restructure the whole thing. Sometimes the director and the actors can’t understand why if we make the slightest change it affects everything. But it’s like taking a little cog out of a watch and then wondering why the watch doesn’t work.”

Mantel, clearly, will do whatever it takes. She adores “the unnerving exhilaration of writing scenes in the middle of the night and handing them to actors at ten o’clock the following morning. The buzz of that is like nothing else. It’s the pressure, and the fact that you are thinking on your feet.” Her face is lit with pleasure. “I’m not dissing the Booker prizes! It’s just that this is something so unexpected. We all hope that if we work and work and work we might win the Man Booker one day. So that was within . . .” she chooses her words carefully, as she always does, “not expectation, but it was reasonable to hope for. This was not reasonable to hope for!”

Now she really is laughing with delight. “There have been extraordinary times late in rehearsals where Ben” – Ben Miles as Thomas Cromwell, the production’s riveting focal point – “would say, ‘I don’t think that line’s right. Give me a new one, Hilary’ – and there’s your line. There’s something very bracing about that atmosphere.”

Bracing – and perhaps just a little bit eerie. For it becomes apparent during the course of our conversation that it is not just Mike Poulton she’s been working with. In Ben Miles she has, it seems, a living, breathing personification of her complex and chilling protagonist, dead these past five centuries or so. Miles, who is almost never offstage for the plays’ six-hour running time, has created his Cromwell not only from the scripts but also from a total immersion in the books that are their source. He is, Mantel remarks to me at one point, “the only one who really understands the structure of Wolf Hall”; perhaps in part because he made himself a timeline of the novel, and of Cromwell’s life, which he kept pinned up on the walls of an office he had in the rehearsal rooms of the RSC. “It was like that scene in A Beautiful Mind,” he tells me, “when Russell Crowe’s office is discovered and there are just these scribblings everywhere.”

The experience of working with Mantel, Miles says, is “unique”. “I feel I can get as close as I can without actually sitting down with the guy. With Cromwell,” he says. “When you are rehearsing classic plays, particularly Shakespeare, there’s often a moment when the director says, ‘If only we could call him on the phone and ask him what he meant by that line or this scene.’ With Wolf Hall and Bring Up the Bodies, you can. You can email the author and she will give you a fabulous three-page essay on a look; or she’ll send one killer line which will explain half an hour of dialogue. Early on I realised that we had, running alongside the rehearsals and the staging, a seam of gold in Hilary. And she does it in the most humble, enthusiastic way – it’s as if she wrote these books last month!”

She is, of course, still writing them – at least, the final volume of Cromwell’s life, The Mirror and the Light – and this is where things start to get spooky. “There is a scene in Bring Up the Bodies when Henry says to Cromwell: We ought to go on a trip down to Kent, we ought to go to the Weald,” Mantel says. “And the trip never happens. It’s just a Henry fantasy. But talking to Ben about that scene the other week I said to him, ‘I think that if you give it three or four years Henry will think that trip did happen.’ And he responded so positively that I went away and thought about it – and two days ago I saw exactly how that scene should be placed [in The Mirror and the Light]. And so I wrote it.

“That kind of thing, well – it’s not usual! That scene wouldn’t be there if I hadn’t had the conversation with Ben. So plays don’t normally work like this, and novels don’t normally work like this. But this is different, and the two things are feeding each other.”

In the hours I spend with Mantel in Stratford her enjoyment of the relationships she has formed here is palpable, as is her gratitude for the circumstances that have brought her here, not the least of which is the fact that her health is much better than it has been in a long time. “A year ago I knew this was going to happen, but I didn’t know what a difference it would make in my life. I’ve had huge health problems over the years, but the last year has been better, and the best year, really, since I was a girl, in terms of not having chronic pain.” She suffers from endometriosis, which causes not only chronic pain but many other problems, too. She has said to me in the past that her life has been “needlessly hard” because of it; she dismisses the idea that there is any stoic self-improvement to be gained by suffering. She is very, very glad not to suffer. “Not to sound pathetic, but it was just such a presence in my life,” she says now. “I’m not out of the woods, but at an earlier time in my life if this [the stage adaptations] had come along I wouldn’t have been able to take advantage of it. By which I mean, I wouldn’t have been able to be always on the M5, or working really strange hours. So it’s really very special the way this has worked out.”

So it is not just hard work, but luck that has its part to play, too. Everything has changed for her, she knows, because of those two Man Booker prizes; but the books “could well not have won either”, she says. She recalls the time she was a Booker judge, 1990, the year that A S Byatt’s Possession (rightly regarded as a modern classic) took the prize. But: “That year Chatto & Windus [the publisher of Possession] had about five titles that could have been put in for the prize. There was a wonderful David Malouf novel from Chatto, The Great World, which I still think about.” That novel doesn’t even appear on the shortlist of that year’s prize. “And whether it had been a different publisher, in a different year . . . ?”

So she is slightly hesitant about recent changes that have been made to the prize – of which I am a judge this year. It’s not the fact of Americans being eligible that bothers her; but that imprints which have had greater success in past years of the prize will be able to submit more titles than imprints which have not. Previously, every imprint could submit two titles, full stop. “Unfortunately, this means that not all authors have a level playing field any more. Because your success as an author is tied to the success of another author – one who you may not even know, who happens to be published by your publishing house. That to me seems the most undesirable aspect of it.”

But now there can be no talk of prizes; she is hard at work on The Mirror and the Light, and there will be a book of contemporary short stories published in the autumn, provocatively titled The Assassination of Margaret Thatcher. Although she is no longer the ardent socialist she was in her youth, it’s clear from our talk about the Kate Middleton fiasco that she still has plenty to say about the present day. And there will, of course, be television versions of Wolf Hall and Bring Up the Bodies, to be screened – most likely – some time next year, adapted by Peter Straughan. She has been much less involved in these than in the plays. Straughan, she says, “has a very sure touch, and a lot of the problems you have on stage you simply don’t have. One of them is that he can have a much bigger cast.” There will be no feature film. Thomas Cromwell’s story, and the story of his king, could never be squeezed into Hollywood’s standard couple of hours.

Last summer I chaired an event with Mantel at her home-town literary festival in Budleigh Salterton (she is its president) where she read a scene from the new novel, something she had not done before and would not do anywhere else. That scene, from the book’s opening – the morning after Jane Seymour’s bridal night with the king – was hilarious, and dialogue-heavy, and I wondered now, having seen Mike Poulton’s plays, whether just the fact of working so closely with scripts had influenced her style. She dismissed that idea. “That particular scene was written long before this started. I’ve got all sorts of material that goes right to the end of the book. But it does affect it in a very strange way. It isn’t that I will change my style. There would be a temptation perhaps to make a bare novelisation of a play that you are already shaping in your head; but it won’t be like that at all. I think that would be cheating my reader. They want the complexity, they want the detail. And we want to get back all the characters we haven’t had in the plays.”

But the past months have been a transformative experience, that is clear. It may well change her future as a writer, once The Mirror and the Light is finished.

“It’s just extending the frontiers of what you can do, and seeing things opening up for the future. Now, if Mike and I want to work on something, we can do it. If I want to write a play, by myself, I can get a commission. It’s not that I intend to do these things – my first commitment is to the third Cromwell book, everything revolves around that –  but it’s great to have the options.”

And here is the mark of Mantel the artist. Just because you work hard at your trade doesn’t mean you ever master it. “The inner process, the writing life, it doesn’t change at all. Every day is like the first day, it’s like being a beginner. There’s no time for complacency. You need to be extending your range all the time.”

“Wolf Hall” and “Bring Up the Bodies” are at the Aldwych Theatre, London WC2, from 1 May

]]>
<![CDATA[H G Wells: “It seems to me that I am more to the Left than you, Mr Stalin”]]>

Portrait of Josef Stalin (1933) by Isaak Izrailevich. Image: Bridgeman Art Library

 

In 1934, H G Wells arrived in Moscow to meet Soviet writers interested in joining the international PEN Club, of which he was then president. While there, Stalin granted him an interview. His deferential conversation was criticised by J M Keynes and George Bernard Shaw, among others, in the New Statesman. First published as a special NS supplement on 27 October 1934.

 

Wells I am very much obliged to you, Mr Stalin, for agreeing to see me. I was in the United States recently. I had a long conversation with President Roosevelt and tried to ascertain what his leading ideas were. Now I have come to ask you what you are doing to change the world . . .

Stalin Not so very much.

Wells I wander around the world as a common man and, as a common man, observe what is going on around me.

Stalin Important public men like yourself are not “common men”. Of course, history alone can show how important this or that public man has been; at all events, you do not look at the world as a “common man”.

Wells I am not pretending humility. What I mean is that I try to see the world through the eyes of the common man, and not as a party politician or a responsible administrator. My visit to the United States excited my mind. The old financial world is collapsing; the economic life of the country is being reorganised on new lines.

Lenin said: “We must learn to do business,” learn this from the capitalists. Today the capitalists have to learn from you, to grasp the spirit of Socialism. It seems to me that what is taking place in the United States is a profound reorganisation, the creation of planned, that is, Socialist, economy. You and Roosevelt begin from two different starting points. But is there not a relation in ideas, a kinship of ideas, between Moscow and Washington?

In Washington I was struck by the same thing I see going on here; they are building offices, they are creating a number of state regulation bodies, they are organising a long-needed civil service. Their need, like yours, is directive ability.

 

America and Russia

Stalin The United States is pursuing a different aim from that which we are pursuing in the USSR. The aim which the Americans are pursuing arose out of the economic troubles, out of the economic crisis. The Americans want to rid themselves of the crisis on the basis of private capitalist activity, without changing the economic basis. They are trying to reduce to a minimum the ruin, the losses caused by the existing economic system.

Here, however, as you know, in place of the old, destroyed economic basis, an entirely different, a new economic basis has been created. Even if the Americans you mention partly achieve their aim, ie, reduce these losses to a minimum, they will not destroy the roots of the anarchy which is inherent in the existing capitalist system. They are preserving the economic system which must inevitably lead, and cannot but lead, to anarchy in production. Thus, at best, it will be a matter, not of the reorganisation of society, not of abolishing the old social system which gives rise to anarchy and crises, but of restricting certain of its excesses. Subjectively, perhaps, these Americans think they are reorganising society; objectively, however, they are preserving the present basis of society. That is why, objectively, there will be no reorganisation of society.

Nor will there be planned economy. What is planned economy? What are some of its attributes? Planned economy tries to abolish unemployment. Let us suppose it is possible, while preserving the capitalist system, to reduce unemployment to a certain minimum. But surely, no capitalist would ever agree to the complete abolition of unemployment, to the abolition of the reserve army of unemployed, the purpose of which is to bring pressure on the labour market, to ensure a supply of cheap labour. You will never compel a capitalist to incur loss to himself and agree to a lower rate of profit for the sake of satisfying the needs of the people.

Without getting rid of the capitalists, without abolishing the principle of private property in the means of production, it is impossible to create planned economy.

Wells I agree with much of what you have said. But I would like to stress the point that if a country as a whole adopts the principle of planned economy, if the government, gradually, step by step, begins consistently to apply this principle, the financial oligarchy will at last be abolished and Socialism, in the Anglo-Saxon meaning of the word, will be brought about.

The effect of the ideas of Roosevelt’s “New Deal” is most powerful, and in my opinion they are Socialist ideas. It seems to me that instead of stressing the antagonism between the two worlds, we should, in the present circumstances, strive to establish a common tongue for all the constructive forces.

Stalin In speaking of the impossibility of realising the principles of planned economy while preserving the economic basis of capitalism, I do not in the least desire to belittle the outstanding personal qualities of Roosevelt, his initiative, courage and determination. Undoubtedly Roosevelt stands out as one of the strongest figures among all the captains of the contemporary capitalist world. That is why I would like once again to emphasise the point that my conviction that planned economy is impossible under the conditions of capitalism does not mean that I have any doubts about the personal abilities, talent and courage of President Roosevelt.

But if the circumstances are unfavourable, the most talented captain cannot reach the goal you refer to. Theoretically, of course, the possibility of marching gradually, step by step, under the conditions of capitalism, towards the goal which you call Socialism in the Anglo-Saxon meaning of the word, is not precluded. But what will this “Socialism” be? At best, bridling to some extent the most unbridled of individual representatives of capitalist profit, some increase in the application of the principle of regulation in national economy. That is all very well. But as soon as Roosevelt, or any other captain in the contemporary bourgeois world, proceeds to undertake something serious against the foundation of capitalism, he will inevitably suffer utter defeat. The banks, the industries, the large enterprises, the large farms are not in Roosevelt’s hands. All these are private property. The railroads, the mercantile fleet, all these belong to private owners. And, finally, the army of skilled workers, the engineers, the technicians, these too are not at Roosevelt’s command, they are at the command of the private owners; they all work for the private owners.

We must not forget the functions of the State in the bourgeois world. The State is an institution that organises the defence of the country, organises the maintenance of “order”; it is an apparatus for collecting taxes. The capitalist State does not deal much with economy in the strict sense of the word; the latter is not in the hands of the State. On the contrary, the State is in the hands of capitalist economy. That is why I fear that in spite of all his energies and abilities, Roosevelt will not achieve the goal you mention, if indeed that is his goal. Perhaps in the course of several generations it will be possible to approach this goal somewhat; but I personally think that even this is not very probable.

 

Socialism and Individualism

Wells Perhaps I believe more strongly in the economic interpretation of politics than you do. Huge forces striving for better organisation, for the better functioning of the community, that is, for Socialism, have been brought into action by invention
and modern science. Organisation, and the regulation of individual action, have become mechanical necessities, irrespective of social theories. If we begin with the State control of the banks and then follow with the control of the heavy industries, of industry in general, of commerce, etc, such an all-embracing control will be equivalent to the State ownership of all branches of national economy.

Socialism and Individualism are not opposites like black and white. There are many intermediate stages between them. There is Individualism that borders on brigandage, and there is discipline and organisation that are the equivalent of Socialism. The introduction of planned economy depends, to a large degree, upon the organisers of economy, upon the skilled technical intelligentsia who, step by step, can be converted to the Socialist principles of organisation. And this is the most important thing, because organisation comes before Socialism. It is the more important fact. Without organisation the Socialist idea is a mere idea.

Stalin There is no, nor should there be, irreconcilable contrast between the individual and the collective, between the interests of the individual person and the interests of the collective. There should be no such contrast, because collectivism, Socialism, does not deny, but combines individual interests with the interests of the collective. Socialism cannot abstract itself from individual interests.

Socialist society alone can most fully satisfy these personal interests. More than that, Socialist society alone can firmly safeguard the interests of the individual. In this sense there is no irreconcilable contrast between Individualism and Socialism. But can we deny the contrast between classes, between the propertied class, the capitalist class, and the toiling class, the proletarian class? On the one hand we have the propertied class which owns the banks, the factories, the mines, transport, the plantations in colonies. These people see nothing but their own interests, their striving after profits. They do not submit to the will of the collective; they strive to subordinate every collective to their will. On the other hand we have the class of the poor, the exploited class, which owns neither factories nor works, nor banks, which is compelled to live by selling its labour power to the capitalists and which lacks the opportunity to satisfy its most elementary requirements.

How can such opposite interests and strivings be reconciled? As far as I know, Roosevelt has not succeeded in finding the path of conciliation between these interests. And it is impossible, as experience has shown. Incidentally, you know the situation in the US better than I do, as I have never been there and I watch American affairs mainly from literature. But I have some experience in fighting for Socialism, and this experience tells me that if Roosevelt makes a real attempt to satisfy the interests of the proletarian class at the expense of the capitalist class, the latter will put another President in his place. The capitalists will say: Presidents come and Presidents go, but we go on for ever; if this or that President does not protect our interests, we shall find another. What can the President oppose to the will of the capitalist class?

Wells I object to this simplified classification of mankind into poor and rich. Of course there is a category of people which strive only for profit. But are not these people regarded as nuisances in the West just as much as here? Are there not plenty of people in the West for whom profit is not an end, who own a certain amount of wealth, who want to invest and obtain a profit from this investment, but who do not regard this as the main object? In my opinion there is a numerous class of people who admit that the present system is unsatisfactory and who are destined to play a great role in future capitalist society.

During the past few years I have been much engaged in and have thought of the need for conducting propaganda in favour of Socialism and cosmopolitanism among wide circles of engineers, airmen, military technical people, etc. It is useless to approach these circles with two-track class-war propaganda. These people understand the condition of the world. They understand that it is a bloody muddle, but they regard your simple class-war antagonism as nonsense.

Beyond rich vs poor: the writer H G Wells. Photo: Corbis

 

The class war

Stalin You object to the simplified classification into rich and poor. Of course there is a middle stratum, there is the technical intelligentsia that you have mentioned and among which there are very good and very honest people. Among them there are also dishonest and wicked people; there are all sorts of people among them. But first of all mankind is divided into rich and poor, into property owners and exploited; and to abstract oneself from this fundamental division and from the antagonism between poor and rich means abstracting oneself from the fundamental fact.

I do not deny the existence of intermediate middle strata, which either take the side of one or the other of these two conflicting classes, or else take up a neutral or semi-neutral position in the struggle. But, I repeat, to abstract oneself from this fundamental division in society and from the fundamental struggle between the two main classes means ignoring facts. The struggle is going on and will continue. The outcome will be determined by the proletarian class – the working class.

Wells But are there not many people who are not poor, but who work and work productively?

Stalin Of course, there are small landowners, artisans, small traders, but it is not these people who decide the fate of a country, but the toiling masses, who produce all the things society requires.

Wells But there are very different kinds of capitalists. There are capitalists who only think about profit, about getting rich; but there are also those who are prepared to make sacrifices. Take old [J P] Morgan, for example. He only thought about profit; he was a parasite on society, simply, he merely accumulated wealth. But take [John D] Rockefeller. He is a brilliant organiser; he has set an example of how to organise the delivery of oil that is worthy of emulation.

Or take [Henry] Ford. Of course Ford is selfish. But is he not a passionate organiser of rationalised production from whom you take lessons? I would like to emphasise the fact that recently an important change in opinion towards the USSR has taken place in English-speaking countries. The reason for this, first of all, is the position of Japan, and the events in Germany. But there are other reasons besides those arising from international politics. There is a more profound reason, namely, the recognition by many people of the fact that the system based on private profit is breaking down. Under these circumstances, it seems to me, we must not bring to the forefront the antagonism between the two worlds, but should strive to combine all the constructive movements, all the constructive forces in one line as much as possible. It seems to me that I am more to the Left than you, Mr Stalin; I think the old system is nearer to its end than you think.

 

The technician class

Stalin In speaking of the capitalists who strive only for profit, only to get rich, I do not want to say that these are the most worthless people, capable of nothing else. Many of them undoubtedly possess great organising talent, which I do not dream of denying. We Soviet people learn a great deal from the capitalists. And Morgan, whom you characterise so unfavourably, was undoubtedly a good, capable organiser. But if you mean people who are prepared to reconstruct the world, of course, you will not be able to find them in the ranks of those who faithfully serve the cause of profit. We and they stand at opposite poles.

You mentioned Ford. Of course, he is a capable organiser of production. But don’t you know his attitude towards the working class? Don’t you know how many workers he throws on the street? The capitalist is riveted to profit; and no power on earth can tear him away from it. Capitalism will be abolished, not by “organisers” of production, not by the technical intelligentsia, but by the working class, because the aforementioned strata do not play an independent role. The engineer, the organiser of production, does not work as he would like to, but as he is ordered, in such a way as to serve the interests of his employers. There are exceptions of course; there are people in this stratum who have awakened from the intoxication of capitalism. The technical intelligentsia can, under certain conditions, perform miracles and greatly benefit mankind. But it can also cause great harm.

We Soviet people have not a little experience of the technical intelligentsia. After the October Revolution, a certain section of the technical intelligentsia refused to take part in the work of constructing the new society; they opposed this work of construction and sabotaged it. We did all we possibly could to bring the technical intelligentsia into this work of construction; we tried this way and that. Not a little time passed before our technical intelligentsia agreed actively to assist the new system. Today the best section of this technical intelligentsia is in the front rank of the builders of Socialist society. Having this experience, we are far from underestimating the good and the bad sides of the technical intelligentsia, and we know that on the one hand it can do harm, and on the other hand it can perform “miracles”.

Of course, things would be different if it were possible, at one stroke, spiritually to tear the technical intelligentsia away from the capitalist world. But that is Utopia. Are there many of the technical in­telligentsia who would dare break away from the bourgeois world and set to work reconstructing society? Do you think there are many people of this kind, say, in England or in France? No; there are few who would be willing to break away from their employers and begin reconstructing the world.

 

Achievement of political power

Stalin Besides, can we lose sight of the fact that in order to transform the world it is necessary to have political power? It seems to me, Mr Wells, that you greatly underestimate the question of political power, that it entirely drops out of your conception.

What can those, even with the best intentions in the world, do if they are unable to raise the question of seizing power, and do not possess power? At best they can help the class which takes power, but they cannot change the world themselves. This can only be done by a great class which will take the place of the capitalist class and become the sovereign master as the latter was before. This class is the working class. Of course, the assistance of the technical intelligentsia must be accepted; and the latter, in turn, must be assisted. But it must not be thought that the technical intelligentsia can play an independent historical role.

The transformation of the world is a great, complicated and painful process. For this task a great class is required. Big ships go on long voyages.

Wells Yes, but for long voyages a captain and navigator are required.

Stalin That is true; but what is first required for a long voyage is a big ship. What is a navigator without a ship? An idle man.

Wells The big ship is humanity, not a class.

Stalin You, Mr Wells, evidently start out with the assumption that all men are good. I, however, do not forget that there are many wicked men. I do not believe in the goodness of the bourgeoisie.

Wells I remember the situation with regard to the technical intelligentsia several decades ago. At that time the technical intelligentsia was numerically small, but there was much to do and every engineer, technician and intellectual found his opportunity. That is why the technical intelligentsia was the least revolutionary class. Now, however, there is a super­abundance of technical intellectuals, and their mentality has changed very sharply. The skilled man, who would formerly never listen to revolutionary talk, is now greatly interested in it.

Recently I was dining with the Royal Society, our great English scientific society. The President’s speech was a speech for social planning and scientific control. Thirty years ago, they would not have listened to what I say to them now. Today, the man at the head of the Royal Society holds revolutionary views, and insists on the scientific reorganisation of human society. Your class-war propaganda has not kept pace with these facts. Mentality changes.

Stalin Yes, I know this, and this is to be explained by the fact that capitalist society is now in a cul de sac. The capitalists are seeking, but cannot find, a way out of this cul de sac that would be compatible with the dignity of this class, compatible with the interests of this class. They could, to some extent, crawl out of the crisis on their hands and knees, but they cannot find an exit that would enable them to walk out of it with head raised high, a way out that would not fundamentally disturb the interests of capitalism.

This, of course, is realised by wide circles of the technical intelligentsia. A large section of it is beginning to realise the community of its interests with those of the class which is capable of pointing the way out of the cul de sac.

Wells You of all people know something about revolutions, Mr Stalin, from the practical side. Do the masses ever rise? Is it not an established truth that all revolutions are made by a minority?

Stalin To bring about a revolution a leading revolutionary minority is required; but the most talented, devoted and energetic minority would be helpless if it did not rely upon the at least passive support of millions.

Wells At least passive? Perhaps subconscious?

Stalin Partly also the semi-instinctive and semi-conscious, but without the support of millions, the best minority is impotent.

 

The place of violence

Wells I watch Communist propaganda in the West, and it seems to me that in modern conditions this propaganda sounds very old-fashioned, because it is insurrectionary propaganda.

Propaganda in favour of the violent overthrow of the social system was all very well when it was directed against tyranny. But under modern conditions, when the system is collapsing anyhow, stress should be laid on efficiency, on competence, on productiveness, and not on insurrection.

It seems to me that the insurrectionary note is obsolete. The Communist propaganda in the West is a nuisance to constructive-minded people.

Stalin Of course the old system is breaking down, decaying. That is true. But it is also true that new efforts are being made by other methods, by every means, to protect, to save this dying system. You draw a wrong conclusion from a correct postulate. You rightly state that the old world is breaking down. But you are wrong in thinking that it is breaking down of its own accord. No; the substitution of one social system for another is a complicated and long revolutionary process. It is not simply a spontaneous process, but a struggle; it is a process connected with the clash of classes.

Capitalism is decaying, but it must not be compared simply with a tree which has decayed to such an extent that it must fall to the ground of its own accord. No, revolution, the substitution of one social system for another, has always been a struggle, a painful and a cruel struggle, a life-and-death struggle. And every time the people of the new world came into power they had to defend themselves against the attempts of the old world to restore the old power by force; these people of the new world always had to be on the alert, always had to be ready to repel the attacks of the old world upon the new system.

Yes, you are right when you say that the old social system is breaking down; but it is not breaking down of its own accord. Take Fascism for example. Fascism is a reactionary force which is trying to preserve the old system by means of violence. What will you do with the Fascists? Argue with them? Try to convince them? But this will have no effect upon them at all. Communists do not in the least idealise methods of violence. But they, the Communists, do not want to be taken by surprise; they cannot count on the old world voluntarily departing from the stage; they see that the old system is violently defending itself, and that is why the Communists say to the working class: Answer violence with violence; do all you can to prevent the old dying order from crushing you, do not permit it to put manacles on your hands, on the hands with which you will overthrow the old system.

As you see, the Communists regard the substitution of one social system for another, not simply as a spontaneous and peaceful process, but as a complicated, long and violent process. Communists cannot ignore facts.

Wells But look at what is now going on in the capitalist world. The collapse is not a simple one; it is the outbreak of reactionary violence which is degenerating to gangsterism. And it seems to me that when it comes to a conflict with reactionary and unintelligent violence, Socialists can appeal to the law, and instead of regarding the police as the enemy they should support them in the fight against the reactionaries. I think that it is useless operating with the methods of the old insurrectionary Socialism.

 

The lessons of history

Stalin The Communists base themselves on rich historical experience which teaches that obsolete classes do not voluntarily abandon the stage of history.

Recall the history of England in the seventeenth century. Did not many say that the old social system had decayed? But did it not, nevertheless, require a Cromwell to crush it by force?

Wells Cromwell acted on the basis of the constitution and in the name of constitutional order.

Stalin In the name of the constitution he resorted to violence, beheaded the king, dispersed Parliament, arrested some and beheaded others!

Or take an example from our history. Was it not clear for a long time that the Tsarist system was decaying, was breaking down? But how much blood had to be shed in order to overthrow it?

And what about the October Revolution? Were there not plenty of people who knew that we alone, the Bolsheviks, were indicating the only correct way out? Was it not clear that Russian capitalism had decayed? But you know how great was the resistance, how much blood had to be shed in order to defend the October Revolution from all its enemies.

Or take France at the end of the eighteenth century. Long before 1789 it was clear to many how rotten the royal power, the feudal system, was. But a popular insurrection, a clash of classes was not, could not be avoided. Why? Because the classes which must abandon the stage of history are the last to become convinced that their role is ended. It is impossible to convince them of this. They think that the fissures in the decaying edifice of the old order can be repaired and saved.

That is why dying classes take to arms and resort to every means to save their existence as a ruling class.

Wells But were there not a few lawyers at the head of the great French Revolution?

Stalin I do not deny the role of the intelligentsia in revolutionary movements. Was the great French Revolution a lawyers’ revolution and not a popular revolution, which achieved victory by rousing vast masses of the people against feudalism and championed the interests of the Third Estate? And did the lawyers among the leaders of the great French Revolution act in accordance with the laws of the old order? Did they not introduce new, bourgeois-revolutionary law?

The rich experience of history teaches that up to now not a single class has voluntarily made way for another class. There is no such precedent in history. The Communists have learned this lesson of history. Communists would welcome the voluntary departure of the bourgeoisie. But such a turn of affairs is improbable, that is what experience teaches. That is why the Communists want to be prepared for the worst and call upon the working class to be vigilant, to be prepared for battle.

Who wants a captain who lulls the vigilance of his army, a captain who does not understand that the enemy will not surrender, that he must be crushed? To be such a captain means deceiving, betraying the working class. That is why I think that what seems to you to be old-fashioned is in fact a measure of revolutionary expediency for the working class.

 

How to make a revolution

Wells I do not deny that force has to be used, but I think the forms of the struggle should fit as closely as possible to the opportunities presented by the existing laws, which must be defended against reactionary attacks. There is no need to disorganise the old system because it is disorganising itself enough as it is. That is why it seems to me insurrection against the old order, against the law, is obsolete, old-fashioned. Incidentally, I exaggerate in order to bring the truth out more clearly. I can formulate my point of view in the following way: first, I am for order; second, I attack the present system in so far as it cannot assure order; third, I think that class war propaganda may detach from Socialism just those educated people whom Socialism needs.

Stalin In order to achieve a great object, an important social object, there must be a main force, a bulwark, a revolutionary class. Next it is necessary to organise the assistance of an auxiliary force for this main force; in this case this auxiliary force is the party, to which the best forces of the intelligentsia belong. Just now you spoke about “educated people”. But what educated people did you have in mind? Were there not plenty of educated people on the side of the old order in England in the seventeenth century, in France at the end of the eighteenth century, and in Russia in the epoch of the October Revolution? The old order had in its service many highly educated people who defended the old order, who opposed the new order.

Education is a weapon the effect of which is determined by the hands which wield it, by who is to be struck down. Of course, the proletariat, Socialism, needs highly educated people. Clearly, simpletons cannot help the proletariat to fight for Socialism, to build a new society.

I do not under-estimate the role of the intelligentsia; on the contrary, I emphasise it. The question is, however, which intelligentsia are we discussing? Because there are different kinds of intelligentsia.

Wells There can be no revolution without a radical change in the educational system. It is sufficient to quote two examples – the example of the German Republic, which did not touch the old educational system, and therefore never became a republic; and the example of the British Labour Party, which lacks the determination to insist on a radical change in the educational system.

Stalin That is a correct observation. Permit me now to reply to your three points. First, the main thing for the revolution is the existence of a social bulwark. This bulwark of the revolution is the working class.

Second, an auxiliary force is required, that which the Communists call a Party. To the Party belong the intelligent workers and those elements of the technical intelligentsia which are closely connected with the working class. The intelligentsia can be strong only if it combines with the working class. If it opposes the working class it becomes a cipher.

Third, political power is required as a lever for change. The new political power creates the new laws, the new order, which is revolutionary order.

I do not stand for any kind of order. I stand for order that corresponds to the interests of the working class. If, however, any of the laws of the old order can be utilised in the interests of the struggle for the new order, the old laws should be utilised.

And, finally, you are wrong if you think that the Communists are enamoured of violence. They would be very pleased to drop violent methods if the ruling class agreed to give way to the working class. But the experience of history speaks against such an assumption.

Wells There was a case in the history of England, however, of a class voluntarily handing over power to another class. In the period between 1830 and 1870, the aristocracy, whose influence was still very considerable at the end of the eighteenth century, voluntarily, without a severe struggle, surrendered power to the bourgeoisie, which serves as a sentimental support of the monarchy. Subsequently, this transference of power led to the establishment of the rule of the financial oligarchy.

Stalin But you have imperceptibly passed from questions of revolution to questions of reform. This is not the same thing. Don’t you think that the Chartist movement played a great role in the reforms in England in the nineteenth century?

Wells The Chartists did little and disappeared without leaving a trace.

Stalin I do not agree with you. The Chartists, and the strike movement which they organised, played a great role; they compelled the ruling class to make a number of concessions in regard to the franchise, in regard to abolishing the so-called “rotten boroughs”, and in regard to some of the points of the “Charter”. Chartism played a not unimportant historical role and compelled a section of the ruling classes to make certain concessions, reforms, in order to avert great shocks. Generally speaking, it must be said that of all the ruling classes, the ruling classes of England, both the aristocracy and the bourgeoisie, proved to be the cleverest, most flexible from the point of view of their class interests, from the point of view of maintaining their power.

Take as an example, say, from modern history, the General Strike in England in 1926. The first thing any other bourgeoisie would have done in the face of such an event, when the General Council of Trade Unions called for a strike, would have been to arrest the Trade Union leaders. The Brit­ish bourgeoisie did not do that, and it acted cleverly from the point of view of its own interests. I cannot conceive of such a flexible strategy being employed by the bourgeoisie in the United States, Germany or France. In order to maintain their rule, the ruling classes of Great Britain have never forsworn small concessions, reforms. But it would be a mistake to think that these reforms were revolutionary.

Wells You have a higher opinion of the ruling classes of my country than I have. But is there a great difference between a small revolution and a great reform? Is not a reform a small revolution?

Stalin Owing to pressure from below, the pressure of the masses, the bourgeoisie may sometimes concede certain partial reforms while remaining on the basis of the existing social-economic system. Acting in this way, it calculates that these concessions are necessary in order to preserve its class rule. This is the essence of reform. Revolution, however, means the transference of power from one class to another. That is why it is impossible to describe any reform as revolution.

 

What Russia is doing wrong

Wells I am very grateful to you for this talk, which has meant a great deal to me. In explaining things to me you probably called to mind how you had to explain the fundamentals of Socialism in the illegal circles before the revolution. At the present time there are only two persons to whose opinion, to whose every word, millions are listening – you and Roosevelt. Others may preach as much as they like; what they say will never be printed or heeded.

I cannot yet appreciate what has been done in your country; I only arrived yesterday. But I have already seen the happy faces of healthy men and women and I know that something very considerable is being done here. The contrast with 1920 is astounding.

Stalin Much more could have been done had we Bolsheviks been cleverer.

Wells No, if human beings were cleverer. It would be a good thing to invent a Five-Year Plan for the reconstruction of the human brain, which obviously lacks many things needed for a perfect social order. [Laughter]

Stalin Don’t you intend to stay for the Congress of the Soviet Writers’ Union?

Wells Unfortunately, I have various engagements to fulfil and I can stay in the USSR only for a week. I came to see you and I am very satisfied by our talk. But I intend to discuss with such Soviet writers as I can meet the possibility of their affiliating to the PEN Club. The organisation is still weak, but it has branches in many countries, and what is more important, the speeches of its members are widely reported in the press. It insists upon this, free expression of opinion – even of opposition opinion. I hope to discuss this point with Gorki. I do not know if you are prepared yet for that much freedom . . .

Stalin We Bolsheviks call it “self-criticism”. It is widely used in the USSR. If there is anything I can do to help you I shall be glad to do so.

]]>